View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_54 (Length: 317)
Name: NF0673_low_54
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 64 - 304
Target Start/End: Complemental strand, 19365722 - 19365482
Alignment:
| Q |
64 |
tcatcagccaaaacagcacccctagtgccagcccgggttcgtttcaaaactttgaactttatatttgtcttcctgtcacagcccaaccaagagtcgcaca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19365722 |
tcatcagccaaaacagcacccctagtgccagcccgggttcgtttcaaaactttgaactttatatttgtcttcctgtcacagcccaaccaagagtcgcaca |
19365623 |
T |
|
| Q |
164 |
aacaatagcaagtcaaattatagttaccctctgatggggcctggaacttgcccattaccaatctagatccccccttcaccttctccactgcttcggcaac |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19365622 |
aacaatagcaagtcaaattatagttaccctctgatggggcctggaacttgcccattaccaatctagatccccccttcaccttctccactgcttcggcaac |
19365523 |
T |
|
| Q |
264 |
tgccctactggtctccttcgggcttgctccggaaccctcct |
304 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19365522 |
tgccttactggtctccttcgggcttgctccggaaccctcct |
19365482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 763 times since January 2019
Visitors: 4393