View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_67 (Length: 292)
Name: NF0673_low_67
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 47 - 231
Target Start/End: Original strand, 8198947 - 8199131
Alignment:
| Q |
47 |
gaggagcagagagggtaagccatggacaacttttgcagcaatgaagcatgtacatcaccatggtttatgttcatattcataggatctttatctttcaata |
146 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8198947 |
gaggagcagtgagggtaagccatggacaacttttgcagcaatgaagcatgtacatcaccatggtttatgttcatattcataggatctttatctttcaata |
8199046 |
T |
|
| Q |
147 |
tcacttcaaaattgttactccctttatcattcacaatggacaaatttggaagagtttctttaaaaatctctaacacgggtctctg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8199047 |
tcacttcaaaattgttactccctttatcattcacaatggacaaatttggaagagtttctttaaaaatctctaacacgggtttctg |
8199131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 590 times since January 2019
Visitors: 4387