View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_73 (Length: 283)
Name: NF0673_low_73
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 21767530 - 21767292
Alignment:
| Q |
16 |
atgtaaaaagactcatcctcacatgatgggttctttcttttttgttcttttggttcatctatctgagtttatatttcctccattaaacttgccaagactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21767530 |
atgtaaaaagactcatcctcacatgatgggttctttcttttttgttcttttggttcatttatctgagtttatatttcctccattaaacttgccaagactc |
21767431 |
T |
|
| Q |
116 |
ggtnnnnnnn-gtagatgtacctgcatcataaattgtacaaaacagactacagacacatgcctactttcccgctttttccatgaagtccaattcaagttc |
214 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21767430 |
ggtaaaaaaaagtagatgtacctacatcataaattgtacaaaacagactacagacacatgcctactttcccgctttttccatgaagtccaattcaagttc |
21767331 |
T |
|
| Q |
215 |
aaccgtgcacttgttttgacgaaattgtgatagaagttc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21767330 |
aaccgtgcacttgttttgacgaaattgtgatagaagttc |
21767292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1224 times since January 2019
Visitors: 4365