View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_78 (Length: 274)
Name: NF0673_low_78
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 24 - 164
Target Start/End: Complemental strand, 5273779 - 5273639
Alignment:
| Q |
24 |
tgagatgaatgaggaaagtgtatggaattgtaacagttctactttgtgtctgtcactgagggaattaaggaaacctggtttgagttttgaaaaggcattg |
123 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5273779 |
tgagatgaatgaggaaagtgtgtggaattgtaacagttctactttgtgtctgtcactgagggaattaaggaaacctggtttgagttttgaaaaggcattg |
5273680 |
T |
 |
| Q |
124 |
tcttctggtgcaaaaagggttaagccaccactgctagaatc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5273679 |
tcttctggtgcaaaaagggttaagccaccactgctagaatc |
5273639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 152
Target Start/End: Complemental strand, 36151243 - 36151143
Alignment:
| Q |
52 |
tgtaacagttctactttgtgtctgtcactgagggaattaaggaaacctggtttgagttttgaaaaggcattgtcttctggtgcaaaaagggttaagccac |
151 |
Q |
| |
|
||||| ||||| ||||| ||||| ||| ||||||| || ||||| |||| ||||||||| || || ||| |||||||||||||||| |||||| |||| |
|
|
| T |
36151243 |
tgtaagagttcgactttttgtctatcagtgagggagttgaggaaccctgctttgagtttggagaatgcagaatcttctggtgcaaaaatggttaacccac |
36151144 |
T |
 |
| Q |
152 |
c |
152 |
Q |
| |
|
| |
|
|
| T |
36151143 |
c |
36151143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 146
Target Start/End: Complemental strand, 36154629 - 36154535
Alignment:
| Q |
52 |
tgtaacagttctactttgtgtctgtcactgagggaattaaggaaacctggtttgagttttgaaaaggcattgtcttctggtgcaaaaagggttaa |
146 |
Q |
| |
|
||||| ||||| ||||| ||||| ||| ||||||| || ||||| |||| ||||||||| || || ||| |||||||||||||||| |||||| |
|
|
| T |
36154629 |
tgtaagagttcgactttttgtctatcagtgagggagttgaggaaccctgctttgagtttggagaatgcagaatcttctggtgcaaaaatggttaa |
36154535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University