View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_79 (Length: 273)
Name: NF0673_low_79
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 31 - 202
Target Start/End: Original strand, 8316668 - 8316839
Alignment:
| Q |
31 |
gaagaatatgaaaggcgtgtggagatagattttgagagcgggatgaaaatagaatcaggtaaaaaggagcagcagtttgtaaattttgttggcagagcac |
130 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316668 |
gaagtatatgaaaggcgtgtggagatagattttgagagcgggatgaaaatagaatcaggtaaaaaggagcagcagtttgtaaattttgttggcagagcac |
8316767 |
T |
|
| Q |
131 |
ttctccttacttcaatctcaagcatggagttggaaagattttctttactgatcaataacaagcgtgatatat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316768 |
ttctccttacttcaatctcaagcatggagttggaaagattttctttactgatcaataacaagcgtgatatat |
8316839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 573 times since January 2019
Visitors: 4387