View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_83 (Length: 269)
Name: NF0673_low_83
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 22 - 261
Target Start/End: Complemental strand, 11464360 - 11464121
Alignment:
Q |
22 |
catcatcatccaaatatggtgagagatctccaatattgaaagttgcatgtactccatattctccgggcaaatcaatcttgtatgcattgtcattgatctt |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11464360 |
catcatcatccaaatatggtgagagatctccaatattgaaagttgcatgtactccatattctccgggcaaatcaatcttgtatgcattgtcattgatctt |
11464261 |
T |
 |
Q |
122 |
tgatataactttgaagggaccatcagctctaggcatgagcttattctttcttttgcttgggaatctctcttttctcaaatggacccatacaagatcacct |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11464260 |
tgatataactttgaagggaccatcagctctaggcatgagcttattctttcttttgcttgggaatctctcttttctcaaatggacccatacaagatcacct |
11464161 |
T |
 |
Q |
222 |
tcgttgaacaacctaggcttattattcttagacctatgct |
261 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |||| |
|
|
T |
11464160 |
tcgttgaacaacttaggcttattattcttagacctttgct |
11464121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University