View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_84 (Length: 269)
Name: NF0673_low_84
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 22 - 262
Target Start/End: Complemental strand, 11464360 - 11464120
Alignment:
| Q |
22 |
catcatcatccaaatatggtgagagatctccaatattgaaagttgcatgtactccatattctccgggcaaatcaatcttgtatgcattgtcattgatctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11464360 |
catcatcatccaaatatggtgagagatctccaatattgaaagttgcatgtactccatattctccgggcaaatcaatcttgtatgcattgtcattgatctt |
11464261 |
T |
 |
| Q |
122 |
tgatataactttgaagggaccatcagctctaggcatgagcttattctttcttttgcttgggaatctctcttttctcaaatggacccatacaagatcacct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11464260 |
tgatataactttgaagggaccatcagctctaggcatgagcttattctttcttttgcttgggaatctctcttttctcaaatggacccatacaagatcacct |
11464161 |
T |
 |
| Q |
222 |
tcgttgaacaacctaggcttattattcttagacctttgctt |
262 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11464160 |
tcgttgaacaacttaggcttattattcttagacctttgctt |
11464120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University