View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_87 (Length: 264)

Name: NF0673_low_87

Description: NF0673

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0673_low_87

[»] chr8 (1 HSPs)

Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)

Name: chr8

Description:

Target: chr8; HSP #1

Raw Score: 37; E-Value: 0.000000000006

Query Start/End: Original strand, 125 - 165

Target Start/End: Original strand, 25839997 - 25840037

Alignment:

Q	125	actattagacactgagttgcttcttcgtgtggttcatctta	165	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|
T	25839997	actattagacactgagttgcttcttcgtgtggttcacctta	25840037	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]