View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_95 (Length: 260)
Name: NF0673_low_95
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 23 - 220
Target Start/End: Complemental strand, 34008776 - 34008576
Alignment:
Q |
23 |
atatacaaaaataaccgttactagttctaaccatactgttattaatttttaacatgagtttacttatttcatcttagaaaacatacatagcttgcttctc |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34008776 |
atatacaaaaataaccgttactagttctaaccatactgttattaatttttaacatgagtttacttatttcatcttagaaaacatacatagcttgcttctc |
34008677 |
T |
 |
Q |
123 |
accttacttacattttatatgaaaataataaccatatctctaagttgatttgaacaagatatacataagag---taattattcctacatcaaaacataac |
219 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
34008676 |
accttacttacattttatatgaaaataataaccatatctctaagttgatttgaacaagatatacataagagtaataattattcctacatcaaaacataac |
34008577 |
T |
 |
Q |
220 |
a |
220 |
Q |
|
|
| |
|
|
T |
34008576 |
a |
34008576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1779 times since January 2019
Visitors: 4432