View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_high_10 (Length: 340)
Name: NF0674_high_10
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 2e-68; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 173 - 304
Target Start/End: Original strand, 33233379 - 33233510
Alignment:
| Q |
173 |
cctccattgcttctaaagtcattacactcagtaagtgtgcttccttcaattagtttgtgcttctttttcgtcttttttccttggtcatcttcacattcat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33233379 |
cctccattgcttctaaagtcattacactcagtaagtgtgcttccttcaattagtttgtgcttctttttcgtcttttttccttggtcatcttcacattcat |
33233478 |
T |
 |
| Q |
273 |
tgcttttgaactcactatactccttatgtgtg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33233479 |
tgcttttgaactcactatactccttatgtgtg |
33233510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 177 - 301
Target Start/End: Original strand, 33233575 - 33233696
Alignment:
| Q |
177 |
cattgcttctaaagtcattacactcagtaagtgtgcttccttcaattagtttgtgcttctttttcgtcttttttccttggtcatc---ttcacattcatt |
273 |
Q |
| |
|
|||||||||||||||||||||| || | |||||| ||||||||||||| |||||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
33233575 |
cattgcttctaaagtcattacattccatcagtgtgtttccttcaattag------cttctttttcatcttctttccttggtcatcagcttcacattcatt |
33233668 |
T |
 |
| Q |
274 |
gcttttgaactcactatactccttatgt |
301 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
33233669 |
acttttgaactcgttatactccttatgt |
33233696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 213 - 300
Target Start/End: Original strand, 33233797 - 33233887
Alignment:
| Q |
213 |
ttccttcaattagtttgtgcttctttttcgtcttttttccttggtcat---cttcacattcattgcttttgaactcactatactccttatg |
300 |
Q |
| |
|
||||||||||||| || ||||||||||| |||| ||||||||||||| |||||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
33233797 |
ttccttcaattagcttccgcttctttttcatcttctttccttggtcatcatcttcacattcattgctattgaactcattatacttcttatg |
33233887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 60 - 112
Target Start/End: Original strand, 33233262 - 33233318
Alignment:
| Q |
60 |
catcatcatcttcacattcattgggtt----caaacttgctatactccttacgttta |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33233262 |
catcatcatcttcacattcattgggttaattcaaacttgctatactccttacgttta |
33233318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 217 - 300
Target Start/End: Complemental strand, 34156385 - 34156299
Alignment:
| Q |
217 |
ttcaattagtttgtgcttctttttcgtcttttttccttggtcatc---ttcacattcattgcttttgaactcactatactccttatg |
300 |
Q |
| |
|
||||||||| || ||||||||||| |||| |||||||||||||| ||||||||||||||| | ||||||| |||||| |||||| |
|
|
| T |
34156385 |
ttcaattagcttccgcttctttttcatcttctttccttggtcatcatcttcacattcattgctatcgaactcattatacttcttatg |
34156299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University