View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_high_15 (Length: 319)
Name: NF0674_high_15
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0674_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 290
Target Start/End: Original strand, 49293073 - 49293350
Alignment:
Q |
9 |
caacaatatagattgaataaagagaatcacagtgaaggactatcaacccatatatacctaggctaaatctctagtatgacaataaatttggcacccatga |
108 |
Q |
|
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49293073 |
caacaaaatagattgaataaagagaatcacagttgaggactatcaacccata----cctaggctaaatctctagtatgacaataaatttggcacccatga |
49293168 |
T |
 |
Q |
109 |
aaatttcaattctccatatcaaaactatgtttggtgtatgcacttgagatcttaaaagagtcttggcattttggttgaactgtcgtcgtcaacttcaata |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49293169 |
aaatttcaattctccatatcaaaactatgtttggtgtatgcacttgagatcttaaaagagtcttggcattttggttgaactgtcgtcgtcaacttcaata |
49293268 |
T |
 |
Q |
209 |
aggtgatgccaacaaagactaaacaagccttcacaaacaataggaatgctaacatatgaaactcctcgtcgtgttcatgagg |
290 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
T |
49293269 |
aggtgatgccaacaaagactaaacaagccttcacaaacaataggaatgctaacatatgaaactcctcgtagtgtttatgagg |
49293350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 17919358 - 17919413
Alignment:
Q |
123 |
catatcaaaactatgtttggtgtatgcacttgagatcttaaaagagtcttggcatt |
178 |
Q |
|
|
|||||||| ||||||||||| ||||||||||||||||| ||||| ||||| |||| |
|
|
T |
17919358 |
catatcaagactatgtttggcgtatgcacttgagatctacaaagaatcttgtcatt |
17919413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University