View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_high_22 (Length: 251)
Name: NF0674_high_22
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_high_22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 58 - 251
Target Start/End: Complemental strand, 29684806 - 29684613
Alignment:
| Q |
58 |
ctcatgtcaccgctagatctgaatgaaaaagacgctgatgaaccaaaaaataaacgaaattgacacaaagagacaattagttatgaagacacaagagtcg |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29684806 |
ctcatgtcaccgctagatctgaatgaaaaagacgctgatgaaccaaaaaataaacgaaactgacacaaagagacaatcagttatgaagacacaagagtcg |
29684707 |
T |
 |
| Q |
158 |
aatacgaaccaagcaaaccatcggaaggagagacaacttgacgctggagatcggaaagatgctagtgcggagagccgacgtcgctcaacgcacc |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29684706 |
aatacgaaccaagcaaaccaccggaaggagagacaacttgacgctggagatcggaaagatgctggtgcggagagccgatgtcgctcaacgcacc |
29684613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University