View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_high_24 (Length: 248)
Name: NF0674_high_24
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_high_24 |
 |  |
|
| [»] scaffold0428 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0428 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: scaffold0428
Description:
Target: scaffold0428; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 2456 - 2594
Alignment:
| Q |
1 |
tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2456 |
tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg |
2555 |
T |
 |
| Q |
101 |
gcacgagctttcttacagtccatcatccctgcacaggtt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2556 |
gcacgagctttcttacagtccatcatccctgcaccggtt |
2594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0428; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 139
Target Start/End: Complemental strand, 15174 - 15059
Alignment:
| Q |
23 |
ccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcggcacgagctttcttacagtcca |
122 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||| | || |||||||||| ||||||| ||| |||||| ||||||||| | || || |||||||||| |
|
|
| T |
15174 |
ccggatttcttgtcagctgataagagaccctttttc-taaggtatgcttgcgccttttcatgataaccttcagtttcggcaagggcattattacagtcca |
15076 |
T |
 |
| Q |
123 |
tcatccctgcacaggtt |
139 |
Q |
| |
|
|| |||| |||| |||| |
|
|
| T |
15075 |
tcgtcccagcaccggtt |
15059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 33258335 - 33258473
Alignment:
| Q |
1 |
tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33258335 |
tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg |
33258434 |
T |
 |
| Q |
101 |
gcacgagctttcttacagtccatcatccctgcacaggtt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33258435 |
gcacgagctttcttacagtccatcatccctgcaccggtt |
33258473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 33414707 - 33414840
Alignment:
| Q |
1 |
tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg |
100 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
33414707 |
tcttccttcagctgctagtcttccggatttcttatcagcggatgagagaccctttttcctgagatatgcttgcgccttttcaagatcgccttccgtttca |
33414806 |
T |
 |
| Q |
101 |
gcacgagctttcttacagtccatcatccctgcac |
134 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
33414807 |
gcaagagctttcttacagtccatcatccctgcac |
33414840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 33293113 - 33293251
Alignment:
| Q |
1 |
tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg |
100 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||| |||||||||||||||| |||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
33293113 |
tcttccttcagctgctagtcttctggatttcttatcagcgaatgagagacccttttttctgaggtatgctttcaccttttcaagatcaccttctgtttca |
33293212 |
T |
 |
| Q |
101 |
gcacgagctttcttacagtccatcatccctgcacaggtt |
139 |
Q |
| |
|
||| ||||||||||||||||||||||||| |||| |||| |
|
|
| T |
33293213 |
gcatgagctttcttacagtccatcatcccagcaccggtt |
33293251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 36 - 128
Target Start/End: Complemental strand, 28873091 - 28872999
Alignment:
| Q |
36 |
cagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcggcacgagctttcttacagtccatcatcc |
128 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||| || |||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
28873091 |
cagcagatgagagacccttttatctgaggtatgcttacgccttttcaagatcaccttctgtttcggcaagggctttcttacagtccatcatcc |
28872999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 33395193 - 33395326
Alignment:
| Q |
1 |
tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcg |
100 |
Q |
| |
|
||||||||| ||||||| || ||||||||||| ||||| ||||||||||||||| | | || |||| ||| | ||||||||||||||||| |||||| |
|
|
| T |
33395193 |
tcttccttcagctgctagcctaccggatttcttgtcagctgatgagagaccctttgttctaaggtatgattgggccttttcaagatcacctttagtttcg |
33395292 |
T |
 |
| Q |
101 |
gcacgagctttcttacagtccatcatccctgcac |
134 |
Q |
| |
|
|| ||||||||||||||||| ||||| |||| |
|
|
| T |
33395293 |
gctaaggctttcttacagtccataatcccagcac |
33395326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 31564984 - 31564920
Alignment:
| Q |
18 |
gtctcccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttca |
82 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
31564984 |
gtcttccggatttcttgtcagcggatgagagacccttttttctgaggtatgcttgcgccttttca |
31564920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 139
Target Start/End: Original strand, 33279079 - 33279194
Alignment:
| Q |
23 |
ccggatttcttatcagcggatgagagaccctttttgatgagatatgcttgcggcttttcaagatcaccttctgtttcggcacgagctttcttacagtcca |
122 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||| | || |||||||||| ||||||| ||| |||||| ||||||||| | || || |||||||||| |
|
|
| T |
33279079 |
ccggatttcttgtcagctgataagagaccctttttc-taaggtatgcttgcgccttttcatgataaccttcagtttcggcaagggcattattacagtcca |
33279177 |
T |
 |
| Q |
123 |
tcatccctgcacaggtt |
139 |
Q |
| |
|
|| |||| |||| |||| |
|
|
| T |
33279178 |
tcgtcccagcaccggtt |
33279194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 57
Target Start/End: Original strand, 33269695 - 33269740
Alignment:
| Q |
12 |
ctgctagtctcccggatttcttatcagcggatgagagacccttttt |
57 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||| |
|
|
| T |
33269695 |
ctgctagtcttgcagacttcttatcagcggatgagagacccttttt |
33269740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 17447842 - 17447703
Alignment:
| Q |
1 |
tcttccttcttctgctagtctcccggatttcttatcagcggatgagagaccc-tttttgatgagatatgcttgcggcttttcaagatcaccttctgtttc |
99 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||||||||||||||||||| ||||| |||| |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
17447842 |
tcttccttcagctgccagtcttccggatttcttatcagcggatgagagaccccttttttctgaggtatgcttgcgccttttcaagatcaccttcagtttc |
17447743 |
T |
 |
| Q |
100 |
ggcacgagctttcttacagtccatcatccctgcacaggtt |
139 |
Q |
| |
|
|||| | ||||||||||||||||| ||||| |||| |||| |
|
|
| T |
17447742 |
ggcaagggctttcttacagtccataatcccagcaccggtt |
17447703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University