View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0674_high_27 (Length: 228)

Name: NF0674_high_27
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0674_high_27
NF0674_high_27
[»] chr3 (1 HSPs)
chr3 (1-136)||(55088114-55088249)
[»] chr4 (1 HSPs)
chr4 (6-106)||(27600525-27600625)


Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 55088114 - 55088249
Alignment:
1 acaaatcaagaaatgaagggtggtttaagtaagatattggaaccacaaaacgcttcttttgagcctctccaacatagactgctacatggccctttggaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55088114 acaaatcaagaaatgaagggtggtttaagtaagatattggaaccacaaaacgcttcttttgagcctctccaacatagactgctacatggccctttggaac 55088213  T
101 attggaatgatttctactatggagatgatgtgatga 136  Q
    ||||||||||||||||||||||||||||||||||||    
55088214 attggaatgatttctactatggagatgatgtgatga 55088249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 6 - 106
Target Start/End: Complemental strand, 27600625 - 27600525
Alignment:
6 tcaagaaatgaagggtggtttaagtaagatattggaaccacaaaacgcttcttttgagcctctccaacatagactgctacatggccctttggaacattgg 105  Q
    |||||||| | ||| || || ||||| ||||||||||||||||| || ||||||||   ||| ||||| ||||||||||  || ||||||||||||||||    
27600625 tcaagaaaggtaggatgattcaagtatgatattggaaccacaaaccgtttcttttgcaactcaccaacgtagactgctatgtgtccctttggaacattgg 27600526  T
106 a 106  Q
    |    
27600525 a 27600525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University