View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_high_27 (Length: 228)
Name: NF0674_high_27
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 55088114 - 55088249
Alignment:
| Q |
1 |
acaaatcaagaaatgaagggtggtttaagtaagatattggaaccacaaaacgcttcttttgagcctctccaacatagactgctacatggccctttggaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55088114 |
acaaatcaagaaatgaagggtggtttaagtaagatattggaaccacaaaacgcttcttttgagcctctccaacatagactgctacatggccctttggaac |
55088213 |
T |
 |
| Q |
101 |
attggaatgatttctactatggagatgatgtgatga |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55088214 |
attggaatgatttctactatggagatgatgtgatga |
55088249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 6 - 106
Target Start/End: Complemental strand, 27600625 - 27600525
Alignment:
| Q |
6 |
tcaagaaatgaagggtggtttaagtaagatattggaaccacaaaacgcttcttttgagcctctccaacatagactgctacatggccctttggaacattgg |
105 |
Q |
| |
|
|||||||| | ||| || || ||||| ||||||||||||||||| || |||||||| ||| ||||| |||||||||| || |||||||||||||||| |
|
|
| T |
27600625 |
tcaagaaaggtaggatgattcaagtatgatattggaaccacaaaccgtttcttttgcaactcaccaacgtagactgctatgtgtccctttggaacattgg |
27600526 |
T |
 |
| Q |
106 |
a |
106 |
Q |
| |
|
| |
|
|
| T |
27600525 |
a |
27600525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University