View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_high_3 (Length: 487)
Name: NF0674_high_3
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0674_high_3 |
 |  |
|
[»] scaffold0415 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 13212444 - 13212184
Alignment:
Q |
1 |
agaagatgaagaaacaccagtgaatgtgccaggaaatggagggttagggtcaccgggaaccatgggaagtcaacaacaacagcagcagaaccagcaacag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13212444 |
agaagatgaagaaacaccagtgaatgtgccaggaaatggagggttagggtcaccgggaaccatgggaagtcaacaacaacagcagcagaaccagcaacag |
13212345 |
T |
 |
Q |
101 |
caacaacttgtagcagatccttatgcttcttcacttttccatggagttcctcaaaatcttctcaattcatgccaattaccagctgaaggttattggggtg |
200 |
Q |
|
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13212344 |
caacaacttgtagcagatcctaatgcttcatcacttttccatggagttcctcaaaatcttctcaattcatgccaattaccagctgaaggttattggggtg |
13212245 |
T |
 |
Q |
201 |
gaagtgctcgtcctcctttttaaccaaaaatgttattcacttaatcacttttctcatcatg |
261 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13212244 |
gaagtgctcgtcctcctttttaaccaaaaatgttattcacttaatcacttttctcatcatg |
13212184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 341 - 398
Target Start/End: Complemental strand, 13212103 - 13212046
Alignment:
Q |
341 |
atctatcacttgttcattctccttataacttagtttaaattgaagacttttctttgat |
398 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13212103 |
atctatcacttgttcattctccttataacttagtttaaattgaagacttttctttgat |
13212046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0415 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0415
Description:
Target: scaffold0415; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 144 - 221
Target Start/End: Original strand, 13478 - 13555
Alignment:
Q |
144 |
gagttcctcaaaatcttctcaattcatgccaattaccagctgaaggttattggggtggaagtgctcgtcctccttttt |
221 |
Q |
|
|
|||||| ||||||| ||| |||||||| |||||||| | ||||||||||||| ||||||||||||||||||| |||| |
|
|
T |
13478 |
gagttcttcaaaattttcacaattcataccaattactacatgaaggttattggtgtggaagtgctcgtcctccatttt |
13555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 144 - 221
Target Start/End: Complemental strand, 29846011 - 29845934
Alignment:
Q |
144 |
gagttcctcaaaatcttctcaattcatgccaattaccagctgaaggttattggggtggaagtgctcgtcctccttttt |
221 |
Q |
|
|
|||||| ||||||| ||| |||||||| |||||||| | ||||||||||||| ||||||||||||||||||| |||| |
|
|
T |
29846011 |
gagttcttcaaaattttcacaattcataccaattactacatgaaggttattggtgtggaagtgctcgtcctccatttt |
29845934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University