View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_15 (Length: 407)
Name: NF0674_low_15
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0674_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 74 - 405
Target Start/End: Original strand, 26895378 - 26895709
Alignment:
Q |
74 |
catcatccgcaaacttggccggaagcgaattcccaacaatatgttccatctgcttaaaccaaggccaatgactagcagaaatacaaccattattcattct |
173 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26895378 |
catcatccgcaaacttggccggaagcgaattcccaacaatatgttccatctgcttaaaccaaggccaatgactagcagaaatacaaccattattcattct |
26895477 |
T |
 |
Q |
174 |
atgtctctctagcttataccttttcttcaaattatcaaccttgttcttacactgttccacactctttgattgattctcacaccgttcactcaccattgaa |
273 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26895478 |
atgtctctctagcttataccttttcttcaaattatcaaccttgttcttacactgttccacactctttgattgattctcacaccgttcactcaccattgaa |
26895577 |
T |
 |
Q |
274 |
gctccttcttcccaatctcttcctcttagattccctcgattcagcagcgtaaatttctctgtatacgcttcgagtaaacacactatcgctgtatcactcc |
373 |
Q |
|
|
||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26895578 |
gctacttcttcccaatctcttcctcttagattccctcgattcagctgcgtaaatttctctgtatacgcttcgagtaaacacactatcgctgtatcactcc |
26895677 |
T |
 |
Q |
374 |
attcttctcgatcctttctatactctgctcct |
405 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
26895678 |
attcttctcgatcctttctatactctgctcct |
26895709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1206 times since January 2019
Visitors: 4407