View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_23 (Length: 362)
Name: NF0674_low_23
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 120 - 271
Target Start/End: Complemental strand, 8297306 - 8297155
Alignment:
| Q |
120 |
tgttggctgagctaaatacatttatggaaaaagcgaaacaattggagaagaagggagaaaatctggataatctggatgaaaaatggatgataattaaggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8297306 |
tgttggctgagctaaatacatttatggaaaaagcgaaacaattggagaagaagggagaaaatctggataatctggatgaaaaatggatgataattaaggt |
8297207 |
T |
|
| Q |
220 |
ggctgtgatggataattctttggtgtttattagatatttcaaaaacttgatg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8297206 |
ggctgtgatggataattctttggtgtttattagatatttcaaaaacttgatg |
8297155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 120 - 267
Target Start/End: Complemental strand, 8300884 - 8300737
Alignment:
| Q |
120 |
tgttggctgagctaaatacatttatggaaaaagcgaaacaattggagaagaagggagaaaatctggataatctggatgaaaaatggatgataattaaggt |
219 |
Q |
| |
|
||||||||||||||| || |||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
8300884 |
tgttggctgagctaattaaatttatggaaaaagagaaacaattcgagaagaagggagaaaatctggatagtcttgacgaaaaatggatgataattaaggt |
8300785 |
T |
|
| Q |
220 |
ggctgtgatggataattctttggtgtttattagatatttcaaaaactt |
267 |
Q |
| |
|
|| |||| |||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
8300784 |
ggttgtgttggataattctttgctgtttgttagatatatcaaaaactt |
8300737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 120 - 222
Target Start/End: Original strand, 18279341 - 18279443
Alignment:
| Q |
120 |
tgttggctgagctaaatacatttatggaaaaagcgaaacaattggagaagaagggagaaaatctggataatctggatgaaaaatggatgataattaaggt |
219 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||||| ||||||||||||||||| |||| | ||||||||||||| || || |
|
|
| T |
18279341 |
tgttggctgagctaaataaatttatggaaaaagataatcaattggagaagaaggttgaaaatctggataatcttgatgtacaatggatgataatcaatgt |
18279440 |
T |
|
| Q |
220 |
ggc |
222 |
Q |
| |
|
||| |
|
|
| T |
18279441 |
ggc |
18279443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 601 times since January 2019
Visitors: 4387