View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_35 (Length: 316)
Name: NF0674_low_35
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0674_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 148 - 304
Target Start/End: Complemental strand, 42703906 - 42703750
Alignment:
Q |
148 |
aataaataatggctagcatcttctttagtttttgatggctagtataatagtattcctttaaacggaagcaaatagtcgaagtcacatttagaggcttgtt |
247 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42703906 |
aataaataatggctagcatcttctttagtttttgatggctagtataatagtattgctttaaacggaagcaaatagtcgaagtcacatttagaggcttgtt |
42703807 |
T |
 |
Q |
248 |
tttatcttgtatatgaatatttttcaacacgcttatacgcaccaatacaactatatt |
304 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42703806 |
tttatcttgtatatgaatatttttcaacacgcttatacgcaccaatacaactatatt |
42703750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 30 - 121
Target Start/End: Complemental strand, 42704024 - 42703933
Alignment:
Q |
30 |
atatgtacatatcaaaagtgtattatttaatcataataacaaggtacatgtgaagaagaaaaaatactcttaaagatggtggaaattgcgaa |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42704024 |
atatgtacatatcaaaagtgtattatttaatcataataacaaggtacatgtgaagaagaaaaaatactcttaaagatggtggaaattgcgaa |
42703933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1698 times since January 2019
Visitors: 4429