View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_38 (Length: 313)
Name: NF0674_low_38
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0674_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 101 - 237
Target Start/End: Original strand, 27313072 - 27313208
Alignment:
Q |
101 |
caaccagtgttccatcaatctggagaaatgcaaatactatgtcagtaattgtaatgatgagtcgctgataaaactaaataattatttttgtgtatgcatc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27313072 |
caaccagtgttccatcaatctggagaaatgcaaataccatgtcagtaattgtaatgaagagtcgctgataaaactaaataattatttttgtgtatgcatc |
27313171 |
T |
 |
Q |
201 |
acctggatgattagattgtctttacaaggccctatga |
237 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
27313172 |
acctggatgattagattgtctttacaaggccctatga |
27313208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1839 times since January 2019
Visitors: 4432