View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_42 (Length: 298)
Name: NF0674_low_42
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 47117063 - 47116941
Alignment:
| Q |
1 |
tctccgcctatccatctacaaaacaagaaattaaaaataatcgttaaaaggtgatcgatcgagtcattgatacgttgatattgcttaccttgctttgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47117063 |
tctccgcctatccatctacaaaacaagaaattaaaaataatcgttaaaaggtgatcga----gtcattgatacgttgatattgcttaccttgctttgtga |
47116968 |
T |
|
| Q |
101 |
tttgatcgttaaaaggtatgaatattt |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47116967 |
tttgatcgttaaaaggtatgaatattt |
47116941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1659 times since January 2019
Visitors: 4426