View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_48 (Length: 279)
Name: NF0674_low_48
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 69 - 270
Target Start/End: Original strand, 20525225 - 20525433
Alignment:
| Q |
69 |
gtggcttcttaatttgaaaatccaattccttatatgggttaattatcccaaattgcatcatcatcatctttg-------gttgaaaaacccaattggtaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20525225 |
gtggcttcttaatttgaaaatccaattccttatatgggttaattatcccaaattgcatcatcatcatctttgcttcttggttgaaaaacccaattggtaa |
20525324 |
T |
 |
| Q |
162 |
acctcatcagtcatcatcatcttagactgaaacagtgaaacccaatcgttattgaacattagtccccatagtcgatgatcgaaatacttctgcatattat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20525325 |
acctcatcagtcatcatcatcttagactgaaacagtgaaacccaattgttattgaacattagtccccatagtcgatgatcgaaatacttctgcatattat |
20525424 |
T |
 |
| Q |
262 |
tagtattat |
270 |
Q |
| |
|
||||||||| |
|
|
| T |
20525425 |
tagtattat |
20525433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University