View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_56 (Length: 260)
Name: NF0674_low_56
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0674_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 38 - 224
Target Start/End: Original strand, 51993256 - 51993432
Alignment:
Q |
38 |
ggtttgcactgtcctattttatacatcacgttgaattccaattgccgtctcatttccnnnnnnnnnnnnngggcctgcgtgtgttcttttaattacttgg |
137 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
51993256 |
ggtttgcactgccctattttatacatcacgttgaattccaattgccgtctcatttccttt----------gggcctgcgtgtgttcttttaattacttgg |
51993345 |
T |
 |
Q |
138 |
gcctcaaagtctggattcatttcttttctcacactactcacttctccattttggctcggcttatattatataatctgaaccaaaaaa |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51993346 |
gcctcaaagtctggattcatttcttttctcacgctactcacttctccattttggctcggcttatattatataatctgaaccaaaaaa |
51993432 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University