View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_57 (Length: 259)
Name: NF0674_low_57
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 35666221 - 35666445
Alignment:
| Q |
23 |
atcatcagtacctttttatgtaacaatctccaaagaagaaaagatttttgaaggaggaataaatcgattccagatagtcagtcttactccaagacaaccc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35666221 |
atcatcagtacctttttatgtaacaatctccaaagaagaaaagatttttgaaggaggaataaatcgattccagatagtc----ttactccaagacaaccc |
35666316 |
T |
|
| Q |
123 |
tgaactagaatgcttcagaaaatataggagccctcagaaaccggcactacctgaactctgaatattaataaataagattcttcaaattttttgttattaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35666317 |
tgaactagaatgcttcagaaaatataggagccctcagaaaccggctctacctgaactctgaatattaataaataagattcttcaaattttttgttattaa |
35666416 |
T |
|
| Q |
223 |
tatataagaagaagccttgtgtctgtgct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35666417 |
tatataagaagaagccttgtgtctgtgct |
35666445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1295 times since January 2019
Visitors: 4413