View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_58 (Length: 255)
Name: NF0674_low_58
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0674_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 22 - 167
Target Start/End: Complemental strand, 47043702 - 47043557
Alignment:
Q |
22 |
catcatcaagtagccacaccgtagttgttgtagttgcaagttggacgtctctaactttaactctcaggttttggaatttgttataatgatgactattttt |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47043702 |
catcatcaagtagccacaccgtagttgttgtagttgcaagttggacgtctctaactttaactctcaggttttggaatttgttataatgatgactattttt |
47043603 |
T |
 |
Q |
122 |
tgtatttatgaatgttattttcagtttaaatagaagattattcttt |
167 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47043602 |
tgtatttatgaatgttattttcagtttaaatagaagattattcttt |
47043557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 198 - 255
Target Start/End: Complemental strand, 47043528 - 47043471
Alignment:
Q |
198 |
gtcaggattacatttttattttatcaatgcatatttttactatgataacgtgaccgtc |
255 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47043528 |
gtcaggattacatttttattttatcaatgcatatttttactatgataacgtgaccgtc |
47043471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 167
Target Start/End: Complemental strand, 17902328 - 17902294
Alignment:
Q |
133 |
atgttattttcagtttaaatagaagattattcttt |
167 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |
|
|
T |
17902328 |
atgttattttcaatttaaatagaagattattcttt |
17902294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 167
Target Start/End: Complemental strand, 1112536 - 1112500
Alignment:
Q |
131 |
gaatgttattttcagtttaaatagaagattattcttt |
167 |
Q |
|
|
|||||||||||||| |||||||||||||||| ||||| |
|
|
T |
1112536 |
gaatgttattttcaatttaaatagaagattaatcttt |
1112500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 134 - 167
Target Start/End: Complemental strand, 23688420 - 23688387
Alignment:
Q |
134 |
tgttattttcagtttaaatagaagattattcttt |
167 |
Q |
|
|
||||||||||| |||||||||||||||||||||| |
|
|
T |
23688420 |
tgttattttcaatttaaatagaagattattcttt |
23688387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University