View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0674_low_61 (Length: 251)

Name: NF0674_low_61
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0674_low_61
NF0674_low_61
[»] chr5 (1 HSPs)
chr5 (58-251)||(29684613-29684806)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 58 - 251
Target Start/End: Complemental strand, 29684806 - 29684613
Alignment:
58 ctcatgtcaccgctagatctgaatgaaaaagacgctgatgaaccaaaaaataaacgaaattgacacaaagagacaattagttatgaagacacaagagtcg 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||    
29684806 ctcatgtcaccgctagatctgaatgaaaaagacgctgatgaaccaaaaaataaacgaaactgacacaaagagacaatcagttatgaagacacaagagtcg 29684707  T
158 aatacgaaccaagcaaaccatcggaaggagagacaacttgacgctggagatcggaaagatgctagtgcggagagccgacgtcgctcaacgcacc 251  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||    
29684706 aatacgaaccaagcaaaccaccggaaggagagacaacttgacgctggagatcggaaagatgctggtgcggagagccgatgtcgctcaacgcacc 29684613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 675 times since January 2019
Visitors: 4390