View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_62 (Length: 250)
Name: NF0674_low_62
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 16 - 140
Target Start/End: Complemental strand, 42870508 - 42870384
Alignment:
| Q |
16 |
acatcatctagtaagcacaccagttacccatagtttagcagatatttaagacgagaaagaacagaatccacaattagtaattggatttgagaatgcagca |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
42870508 |
acatcatatagtaagcacaccagttacccatagtttagcagatatttaagacaagaaagaacagaatccacaatcagtaatcggatttgagaatgcagca |
42870409 |
T |
 |
| Q |
116 |
gattatgccgaattaaggaatctgt |
140 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42870408 |
gattatgccgaattaaggaatctgt |
42870384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University