View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_67 (Length: 246)
Name: NF0674_low_67
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 29456512 - 29456721
Alignment:
| Q |
12 |
gacatcatcagagtccggtatatagagattcgaggtagatgtttacagaactatttaaaaattcaagttgcataatttcttaaaacaaactgccaaatcg |
111 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456512 |
gacatcctcggagtcgagtatatagagattcgaggtagatgtttacagaactatttaaaagttcaagttgcataatttcttaaaacaaactgccaaatcg |
29456611 |
T |
 |
| Q |
112 |
aaggtgtgcagaagaagtcctcaagttgcagttagatagctgcaatgcctaagattcaaataaaagaagatacttgcaagagaaattttttcatcgaagt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456612 |
aaggtgtgcagaagaagtcctcaagttgcagttagatagctgcaatgcctaagattcaaataaaagaagatacttgcaagagaaattttttcatcgaagt |
29456711 |
T |
 |
| Q |
212 |
tacaaagcac |
221 |
Q |
| |
|
||||| |||| |
|
|
| T |
29456712 |
tacaaggcac |
29456721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University