View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_7 (Length: 485)
Name: NF0674_low_7
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 23 - 365
Target Start/End: Complemental strand, 47112109 - 47111767
Alignment:
| Q |
23 |
atcatcaacattgttctcaacggtcatttgatgtctgggactgtgctcttttgtcccaaatttgctggagtggggaatgtttgtttatcatattttaaac |
122 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47112109 |
atcatcaacattgttctcaacgatcatttgatgtctgggactgtgctcttttgtcccaaatttgctggagtggggaatgtttgtttatcatattttaaac |
47112010 |
T |
 |
| Q |
123 |
tatcaaatactattgacttggttgtatagaaagaggtccaaatgaagtgttttgataaattaggacttggttcttttggctgcagatttcattgagatta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47112009 |
tatcaaatactattgacttggttgtatagaaagaggtccaaatgaagtgttttgataaattaggacttggttcttttggctgcagatttcatggagatta |
47111910 |
T |
 |
| Q |
223 |
cgataattggtctgttgctcacatactatggtgcactgttgaaagacaatgggaatttcagtcattgtaatgttatatccctcttgtatggaacgaatgc |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47111909 |
cgataattggtctgttgctcacatactatggtgcactgttgaaagacaatgggaatttcagtcattgtaatgttatatccctcttgtatggaacgaatgc |
47111810 |
T |
 |
| Q |
323 |
tgcaatttgaaaactttttgttacttgtttctttataggatga |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47111809 |
tgcaatttgaaaactttttgttacttgtttctttataggatga |
47111767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 383 - 466
Target Start/End: Original strand, 47117045 - 47117128
Alignment:
| Q |
383 |
gtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccatcttcgccggtgatgatgtc |
466 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
47117045 |
gtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccgtcttcaccggtgatgatgtc |
47117128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University