View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_73 (Length: 230)
Name: NF0674_low_73
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0674_low_73 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 81 - 230
Target Start/End: Complemental strand, 33935687 - 33935538
Alignment:
| Q |
81 |
tctattaaactctcaaattcaattcctcaaaatgactagaacaacaacaatatcagcatcaaattcaattcctcaaattcaagtcctttattggggatga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33935687 |
tctattaaactctcaaattcaattcctcaaaatgactagaacaacaacaacatcaacatcgaattcaattcctcaaattcaagtcctttattcatgatga |
33935588 |
T |
|
| Q |
181 |
aatcgttacacgcactttaattttcatccaacaatatcaacaaacagaac |
230 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
33935587 |
aatcgttacacacacttaaatttccatccaacaatatcaacaaacagaac |
33935538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 346 times since January 2019
Visitors: 4379