View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0674_low_81 (Length: 204)
Name: NF0674_low_81
Description: NF0674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0674_low_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 5297259 - 5297157
Alignment:
Q |
1 |
ctgatagaagacaatgccaaatacttagaaaatcatatgaggaaaaggtaacataacatgcgatgtttctagcaaacatccatgaaagagagtaaagaga |
100 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
5297259 |
ctgatagaaga-aatgccaaatacttagaaaatcatatgaggaaaaggtagcataacatgcgatgtttctagcaaacatccatgaaagagactaaagaga |
5297161 |
T |
 |
Q |
101 |
gaaa |
104 |
Q |
|
|
|||| |
|
|
T |
5297160 |
gaaa |
5297157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University