View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0675_low_4 (Length: 349)
Name: NF0675_low_4
Description: NF0675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0675_low_4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 21 - 349
Target Start/End: Complemental strand, 8136326 - 8135997
Alignment:
| Q |
21 |
acatcatcatccaccattattaagacaagaaggaataaagtcttggaagtcatagacgatacgtcaccatctatataaagttgtaaggtgcnnnnnnnnn |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136326 |
acatcatcatccaccattattaagacaagaaggaataaagtcttggaagtcatagacgatacgtcaccatctatataaagttgtaaggtgcaaaaaaaga |
8136227 |
T |
|
| Q |
121 |
nnnnnnnn-cgttcactacaagataataataatgaaaataaagatggcatcacagtaaatattattatgtcattgtagatgaagccaacaataccaccaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136226 |
aaaaaaaaacgttcactacaagataataataatgaaaataaagatggcatcacagtaaatattattatgtcattgtagatgaagccaacaataccaccaa |
8136127 |
T |
|
| Q |
220 |
caaaattaaacattggctgatgccacatgtttctctattgtctgtgtcagctcatctttctttgctcctaccactttgcccaaaatttttccttctttca |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8136126 |
caaaattaaacattggctgatgccacatgtttctctattgtctgtgtcagctcatctttctttgctcctaccactttgcccaaaattgttccttctttca |
8136027 |
T |
|
| Q |
320 |
caaacacaaacgttggcatggcttcaatag |
349 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
8136026 |
caaaaacaaacgttggcatggcttcaatag |
8135997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1138 times since January 2019
Visitors: 4365