View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0675_low_5 (Length: 290)
Name: NF0675_low_5
Description: NF0675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0675_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 21 - 261
Target Start/End: Complemental strand, 39887851 - 39887611
Alignment:
| Q |
21 |
tgacatagacacaaatacggacatgtcacattgctaatgtccaaacggacaccattcgatatttatttattcacattacctttccaaggagacaactttt |
120 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39887851 |
tgacatagacacaaatacggacacgtcacattgctaatgtccaaacgggcaccattagatatttatttattcacattacctttccaaggagacaactttt |
39887752 |
T |
 |
| Q |
121 |
ttctgttggtaagtttgccaagggtctgctatgcaaaacctcacatagtttgagagaatgaataccattttctgcaacatctctttccctttcattccat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39887751 |
ttctgttggtaagtttgccaagggtctgctatgcaaaacctcacatagtttgagagaatgaataccattttctgcaacatctctttccctttcattccat |
39887652 |
T |
 |
| Q |
221 |
atgtttaggagttccattgatggcgcagttccaattatacc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39887651 |
atgtttaggagttccattgatggcgcagttccaattatacc |
39887611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University