View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0676_high_13 (Length: 201)

Name: NF0676_high_13
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0676_high_13
NF0676_high_13
[»] chr7 (1 HSPs)
chr7 (34-183)||(21672349-21672498)
[»] chr2 (1 HSPs)
chr2 (32-184)||(39406601-39406753)
[»] chr4 (1 HSPs)
chr4 (34-169)||(50430858-50430994)


Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 34 - 183
Target Start/End: Original strand, 21672349 - 21672498
Alignment:
34 tatactatacaccatctcttttcaactcggcggcgacggcagcatacactagcaacctgatattactgtaacagcatcagggcgtaggatgtaaccacca 133  Q
    ||||||||||||  ||||||||||||||||||| |||||| |||||||| ||||||||||  ||| ||| ||| ||||| |||||| ||| |||||| ||    
21672349 tatactatacacagtctcttttcaactcggcggtgacggcggcatacaccagcaacctgacgttattgtgacaacatcatggcgtaagatttaaccatca 21672448  T
134 cgaagtggttattttcgatctcagtgatgaagttttgctcattcgaaatt 183  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||    
21672449 tgaagtggttattttcgatctcagtgatgaagttttgctcattcgaaatt 21672498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 32 - 184
Target Start/End: Complemental strand, 39406753 - 39406601
Alignment:
32 attatactatacaccatctcttttcaactcggcggcgacggcagcatacactagcaacctgatattactgtaacagcatcagggcgtaggatgtaaccac 131  Q
    ||||||||||||||  ||||||||||||||||||||||| || || |||||  ||||||||| |||| ||| | |||||||||||||||||| ||||||     
39406753 attatactatacacggtctcttttcaactcggcggcgactgcggcgtacaccggcaacctgacattattgtgatagcatcagggcgtaggatttaaccat 39406654  T
132 cacgaagtggttattttcgatctcagtgatgaagttttgctcattcgaaattg 184  Q
    ||| |||||||||||||||||||||||||||||| ||||||| ||||||||||    
39406653 cacaaagtggttattttcgatctcagtgatgaagctttgctcgttcgaaattg 39406601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 73; Significance: 1e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 34 - 169
Target Start/End: Complemental strand, 50430994 - 50430858
Alignment:
34 tatactatacaccatctcttttcaactcggcggcgacggcagcatacactagcaacctgatattactgtaacagcatca-gggcgtaggatgtaaccacc 132  Q
    ||||||||||||| |||||||||||||||||||||||||| || ||||| | |||| |||  ||||||| ||| ||||| ||| ||||||| |||| | |    
50430994 tatactatacaccgtctcttttcaactcggcggcgacggcggcgtacacaaacaacttgacgttactgtgacaacatcaggggtgtaggatttaacaatc 50430895  T
133 acgaagtggttattttcgatctcagtgatgaagtttt 169  Q
    |||||||||||||||||||||||||||||||||||||    
50430894 acgaagtggttattttcgatctcagtgatgaagtttt 50430858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University