View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0676_high_7 (Length: 317)
Name: NF0676_high_7
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0676_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 41 - 288
Target Start/End: Original strand, 50529771 - 50530024
Alignment:
| Q |
41 |
atcatatcgtgtttgttgtctgtgactgtgcttaatggtgg------atgttgatcaagaaggatcagttacaaacctgtagcagataaccactgtgatg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529771 |
atcatatcgtgtttgttgtctgtgactgtgcttagtggtggatgtggatgttgatcaagaaggatcagttacaaacctgtagcagataaccactgtgatg |
50529870 |
T |
 |
| Q |
135 |
agtaaaacaacaacgacagcaaccaagtcgatttggttaaacccttccggaaaagaaggaacggtgatcctccatttagcagaagagacaccgactgtgg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529871 |
agtaaaacaacaacgacagcaaccaagtcgatttggttaaacccttccggaaaagaaggaacggtgatcctccatttagcagaagagacaccgactgtgg |
50529970 |
T |
 |
| Q |
235 |
tgccgacgtacttggtgaaacctctggcaactgcagcatttgacatcacgtaat |
288 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50529971 |
tgccgacgtacttggtgaaacctctagcaactgcagcatttgacatcacgtaat |
50530024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University