View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0676_low_18 (Length: 340)
Name: NF0676_low_18
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0676_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 29 - 329
Target Start/End: Complemental strand, 37503170 - 37502870
Alignment:
| Q |
29 |
aaatctaaggcatctctcgtaaaatatcaactaccttcttgactcaaaatccacattttccatttgatgctcatggctccacttgattgttcacaatgat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
37503170 |
aaatctaaggcatctctcgtaaaatatcaactaccttcttgactcaaaatccacattttccatttgatggtcatggctccacttgattgctcacaatgat |
37503071 |
T |
|
| Q |
129 |
ccacatggttctccttcgtccaccaaacaaatttggaaaaaacaattctgttttaacacgcacaaaaccactcgaatcatttctgatgcaggcaccaatg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37503070 |
ccacatggttctccttcgtccaccaaacaaatttggaaaaaacaattctgttttaacacgcacgaaaccactcgaatcatttctgatgcaggcaccaatg |
37502971 |
T |
|
| Q |
229 |
ccttctccattactagcattggaaaatgaggcattgatattgcattacagcatatttggatcaggtttcaaccatctatctctataattggagcaacagc |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37502970 |
ccttctccattactagcattggaaaatgaggcattgatattgcattacagcatatttggatcaggtttcaaccatctatctctataattggagtaacagc |
37502871 |
T |
|
| Q |
329 |
t |
329 |
Q |
| |
|
| |
|
|
| T |
37502870 |
t |
37502870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1459 times since January 2019
Visitors: 4416