View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0676_low_2 (Length: 614)
Name: NF0676_low_2
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0676_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 451; Significance: 0; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 451; E-Value: 0
Query Start/End: Original strand, 76 - 550
Target Start/End: Original strand, 10995327 - 10995801
Alignment:
| Q |
76 |
gaacttaaggatgagctttttgcaaaatctttatggaaacattccaagaagttgccgagtcccagaagcaagtggatgaccaggatgcatctgcagcagc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10995327 |
gaacttaaggatgagctttttgcaaaatctttatggaaacattccaagaagttgccgagtcccagaagcaagtggatgaccaggatgcatctgcagtagc |
10995426 |
T |
 |
| Q |
176 |
ttctgattattcgaatgacaatctgcctctgccatccattcgaggggaggttctaagcattaagatctcacagacagtctatgagaaaggattggatgct |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995427 |
ttctgattattcgaatgacaatctgcctctgccatccattcgaggggaggttctaagcattaagatctcacagacagtctatgagaaaggattggatgct |
10995526 |
T |
 |
| Q |
276 |
tgcaagcggaatttatgcggtcaattggttttaaacaagggtgataaaccttacatgaaaaaggatctagaaatgaaaatctttggaagattacaggcgc |
375 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10995527 |
tgcaagcggaatttacgtggtcaattggttttaaacaagggtgataaaccttacatgaaaaaggatctagaaatgaaaatctttggaatattacaggcgc |
10995626 |
T |
 |
| Q |
376 |
gtggtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaa |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
10995627 |
gtggtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgatcggtttgggcgttgggtacggtgaatttgaaa |
10995726 |
T |
 |
| Q |
476 |
cctggacttttacggttgttcgaatggactaaagacttcagtatctatacgcaacgtaacactcacgcacaggtt |
550 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995727 |
cctggacttttacggttgttcgaatggactaaagacttcagtatctatacgcaacgtaacactcacgcacaggtt |
10995801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 217 - 546
Target Start/End: Complemental strand, 14243633 - 14243297
Alignment:
| Q |
217 |
gaggggaggttctaagcattaagatctcacagacagtctatgagaaaggattggatgcttgcaagcggaatttatgcggtcaattggttttaaacaaggg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||| || |||||||||||||||| |||||| |||||||| |||||||| |
|
|
| T |
14243633 |
gaggggaggttctaagcattaagatctcgcagacagtgtatgagaaaggattggttgtttgcaagcggaatttacgcggtcgtttggttttgaacaaggg |
14243534 |
T |
 |
| Q |
317 |
tgataaaccttacatgaaaaaggatctagaaatgaaaat-------ctttggaagattacaggcgcgtggtccttgcgttctttaggaaggggattttat |
409 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14243533 |
tgataaaccttacatgaaaaatgatctagaactgaaacttcagaagctttggaagattacaggcgcgtggtccttgtgttctttaggaaggggattttat |
14243434 |
T |
 |
| Q |
410 |
gaattctcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacctggacttttacggttgttcgaatggactaaag |
509 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
14243433 |
gaattctcatttgcctccgaggatgatttacgatcggtttgggcgatgggtacggtgaatttgaaacctggactgttgcggttgttcgaatggactaaag |
14243334 |
T |
 |
| Q |
510 |
acttcagtatctatacgcaacgtaacactcacgcaca |
546 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14243333 |
acttcagtatctatacgcaatgtaacactcacgcaca |
14243297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 356 - 480
Target Start/End: Original strand, 8478272 - 8478396
Alignment:
| Q |
356 |
ctttggaagattacaggcgcgtggtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcga |
455 |
Q |
| |
|
|||||||||| |||||||||||||| | | ||||||||| ||||| | ||||||||| | |||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
8478272 |
ctttggaagacatcaggcgcgtggtcccttctttctttaggtaggggttattatgaattttattttgcctccgaggaagatttacgatcggtttgggcga |
8478371 |
T |
 |
| Q |
456 |
tgggtacggtgaatttgaaacctgg |
480 |
Q |
| |
|
|||| ||||| |||||||||||||| |
|
|
| T |
8478372 |
tgggaacggtaaatttgaaacctgg |
8478396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 14248232 - 14248190
Alignment:
| Q |
179 |
tgattattcgaatgacaatctgcctctgccatccattcgaggg |
221 |
Q |
| |
|
||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
14248232 |
tgattctttgaatgacaatctgcctctgccatctattcgaggg |
14248190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 5e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 95 - 176
Target Start/End: Original strand, 44027045 - 44027126
Alignment:
| Q |
95 |
ttgcaaaatctttatggaaacattccaagaagttgccgagtcccagaagcaagtggatgaccaggatgcatctgcagcagct |
176 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44027045 |
ttgcaaaagctttatggaaacattccaagaagttgccgagtcccagaagcaagtggatgaccaggatgcatctgcagcagct |
44027126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 356 - 502
Target Start/End: Complemental strand, 19937911 - 19937765
Alignment:
| Q |
356 |
ctttggaagattacaggcgcgtggtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcga |
455 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||||| ||||| | ||||||||| | |||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
19937911 |
ctttggaagacatcaggcgcgtggtccctgctttctttaggtaggggttattatgaattttattttgcctccgaggaagatttacgatcggtttgggcga |
19937812 |
T |
 |
| Q |
456 |
tgggtacggtgaatttgaaacctggacttttacggttgttcgaatgg |
502 |
Q |
| |
|
|||| ||||| |||||||||||||| | ||| ||||||| |||||| |
|
|
| T |
19937811 |
tgggaacggtaaatttgaaacctggtttgttaaggttgtttgaatgg |
19937765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University