View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0676_low_24 (Length: 319)
Name: NF0676_low_24
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0676_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 101 - 247
Target Start/End: Original strand, 27495816 - 27495962
Alignment:
Q |
101 |
gttatgttgtgtttgtgcactcatcagacaaaggtggccgttttctttagcttctatatcactcactcactttctcacacaaaacactaatataatcaaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
27495816 |
gttatgttgtgtttgtgcactcatcagacaaaggtggccgttttctttagcttctatatcactcactcactttctcacacaaaacactaaaataatcaaa |
27495915 |
T |
 |
Q |
201 |
gatttcttcatcatacaagttctaccttttctcctttcttttctctc |
247 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27495916 |
gatttcttcatcatacaagttctaccttttctcctttcttttctctc |
27495962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 68 times since January 2019
Visitors: 4369