View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0676_low_30 (Length: 283)
Name: NF0676_low_30
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0676_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 54 - 181
Target Start/End: Complemental strand, 41090797 - 41090670
Alignment:
| Q |
54 |
catcatcaccatctcaaacacctacacacaacaaaacccatcaaaacaaaccttcttttacaataccctttacctcaaagtttcaatctttcaagcttct |
153 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090797 |
catcatcaccttctcaaacacctacacacaacaaaacccatcaaaacaaaccttcttttacaataccctttacctcaaagtttcaatctttcaagcttct |
41090698 |
T |
 |
| Q |
154 |
cacacgttttcatttcatcatcttcgta |
181 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41090697 |
cacacgttttcatttcatcatcttcgta |
41090670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University