View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0676_low_37 (Length: 251)
Name: NF0676_low_37
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0676_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 30 - 250
Target Start/End: Original strand, 11461829 - 11462050
Alignment:
Q |
30 |
atgactacatgcggtcacacatatctcaatcgttttgattatgattagacgacttagattttaacttttgtgttctagatcaagaacttaattgctttta |
129 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11461829 |
atgactacaggcggtcacacatatctcaatcgtttcgattattgttagacgacttagattttaacttttgtgttctagatcaagaacttaattgctttta |
11461928 |
T |
 |
Q |
130 |
attgattattattgctactga-tgcagatcaacatgaggtttttatctcaagattggatgctttcatgggcaatcttagtactagtgttggtgtcatgca |
228 |
Q |
|
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11461929 |
attgattattattgctactgattacagatcaacatgaggtttttatctcaagattggatgctttcatgggcaatcttagtactagtgttggtgtcatgca |
11462028 |
T |
 |
Q |
229 |
caccatgcttatcagctactaa |
250 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
11462029 |
caccatgcttatcagctactaa |
11462050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 248
Target Start/End: Original strand, 11472139 - 11472232
Alignment:
Q |
155 |
gatcaacatgaggtttttatctcaagattggatgctttcatgggcaatcttagtactagtgttggtgtcatgcacaccatgcttatcagctact |
248 |
Q |
|
|
|||||||| ||||||| | || ||| |||||| ||||||||||||||| ||| ||||||||| ||||| ||||||||| || |||||||||| |
|
|
T |
11472139 |
gatcaacacgaggtttgtgtcacaaaattggaacctttcatgggcaatcctagcactagtgttattgtcaagcacaccattctcatcagctact |
11472232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2 times since January 2019
Visitors: 4368