View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0676_low_37 (Length: 251)

Name: NF0676_low_37
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0676_low_37
NF0676_low_37
[»] chr2 (2 HSPs)
chr2 (30-250)||(11461829-11462050)
chr2 (155-248)||(11472139-11472232)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 30 - 250
Target Start/End: Original strand, 11461829 - 11462050
Alignment:
30 atgactacatgcggtcacacatatctcaatcgttttgattatgattagacgacttagattttaacttttgtgttctagatcaagaacttaattgctttta 129  Q
    ||||||||| ||||||||||||||||||||||||| ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11461829 atgactacaggcggtcacacatatctcaatcgtttcgattattgttagacgacttagattttaacttttgtgttctagatcaagaacttaattgctttta 11461928  T
130 attgattattattgctactga-tgcagatcaacatgaggtttttatctcaagattggatgctttcatgggcaatcttagtactagtgttggtgtcatgca 228  Q
    ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11461929 attgattattattgctactgattacagatcaacatgaggtttttatctcaagattggatgctttcatgggcaatcttagtactagtgttggtgtcatgca 11462028  T
229 caccatgcttatcagctactaa 250  Q
    ||||||||||||||||||||||    
11462029 caccatgcttatcagctactaa 11462050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 248
Target Start/End: Original strand, 11472139 - 11472232
Alignment:
155 gatcaacatgaggtttttatctcaagattggatgctttcatgggcaatcttagtactagtgttggtgtcatgcacaccatgcttatcagctact 248  Q
    |||||||| ||||||| | || ||| ||||||  ||||||||||||||| ||| |||||||||  ||||| ||||||||| || ||||||||||    
11472139 gatcaacacgaggtttgtgtcacaaaattggaacctttcatgggcaatcctagcactagtgttattgtcaagcacaccattctcatcagctact 11472232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2 times since January 2019
Visitors: 4368