View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0676_low_39 (Length: 250)

Name: NF0676_low_39
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0676_low_39
NF0676_low_39
[»] chr5 (1 HSPs)
chr5 (1-221)||(41240346-41240566)


Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41240566 - 41240346
Alignment:
1 taaaaatgcaacttccgaaattgaaatcatggtagggttggttttgggaattggattacttttgtcatcactatacttcatgataaagaaatcatccaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41240566 taaaaatgcaacttccgaaattgaaatcatggtagggttggttttgggaattggattacttttgtcatcactatacttcatgataaagaaatcatccaaa 41240467  T
101 ttaatgggagagattgaggtaaagaaaaacaatttagattctcctatgaaaaaggctacaagtgaggggagattaaaaggaggagataataataactcag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41240466 ttaatgggagagattgaggtaaagaaaaacaatttagattctcctatgaaaaaggctacaagtgaggggagattaaaaggaggagataataataactcag 41240367  T
201 agcttgtattctttgttgaag 221  Q
    |||||||||||||||||||||    
41240366 agcttgtattctttgttgaag 41240346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University