View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0676_low_40 (Length: 250)
Name: NF0676_low_40
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0676_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 3668564 - 3668800
Alignment:
| Q |
4 |
acaaaaccattcacatccacttcttcaattggtatctcccaccttttcttagccctaatttcactccctaaacacttgttattctccgaaaacgatctct |
103 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||| ||| |||||||||||||||||||| | |
|
|
| T |
3668564 |
acaaaaccactcacatccacttcttcaattggtatctcccatctcttcttagccctgatttcactccctaaacccttattattctccgaaaacgatcttt |
3668663 |
T |
|
| Q |
104 |
tcctcgcatcacc---accaccaccggaattatacctgcttgcaacaattctaccttgtttcaacgatttcttcactgatttttcaccttcaaacagttt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3668664 |
tcctcgcatcaccaccaccaccaccggaattataccggcttgcaacaattctaccttgtttcaacgatttcttcactgatttttcaccttcaaacagctt |
3668763 |
T |
|
| Q |
201 |
cttcggttgaacctgagcaatttcttcatctttcttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3668764 |
cttcggttgaacctgagcaatttcttcatctttcttc |
3668800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1642 times since January 2019
Visitors: 4426