View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0676_low_8 (Length: 432)
Name: NF0676_low_8
Description: NF0676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0676_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 13 - 404
Target Start/End: Original strand, 51875163 - 51875554
Alignment:
| Q |
13 |
attctccttcaaaagcacgtttttctatgatagtctcaatgttttgtggttttggtttgggaattttggctatggtttttactactttgatgagaaatca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51875163 |
attctccttcaaaagcacgtttttctatgatagtctcaatgttttgtggttttggtttgggaattttggctatggtttttactactttgatgagaaatca |
51875262 |
T |
|
| Q |
113 |
atgggggagattgtttactagtgatgacgagattattaatctaacggctatggctttgccaattgttgggctttgtgagattgggaattgcccacaaaca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51875263 |
atgggggagattgtttactagtgatgacgagattattaatctaacggctatggctttgccaattgttgggctttgtgagattgggaattgcccacaaaca |
51875362 |
T |
|
| Q |
213 |
acgggttgtggtgttttaagaggtagtgctagacctacggtaggtgcaaatatcaatttggggtctttttatttggtaggtatgcctgtggctattgttc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51875363 |
acgggttgtggtgttttaagaggtagtgctagacctacggtaggtgcaaatatcaatttggggtctttttatttggtaggtatgcctgtggctattgttc |
51875462 |
T |
|
| Q |
313 |
ttgggtttgttgtgaagatgggttttgttgggctttggtttgggttacttgcagcccaaggatcttgtgctattctcatgttgtatgtgctt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51875463 |
ttgggtttgttgtgaagatgggttttgttgggctttggtttgggttacttgcagcccaaggctcttgtgctattctcatgttgtatgtgctt |
51875554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 180 - 271
Target Start/End: Complemental strand, 45845516 - 45845425
Alignment:
| Q |
180 |
gggctttgtgagattgggaattgcccacaaacaacgggttgtggtgttttaagaggtagtgctagacctacggtaggtgcaaatatcaattt |
271 |
Q |
| |
|
||||| ||||| |||| ||||| ||||||||||| |||||||| || |||||||| | || || |||| |||||||||||||||||||| |
|
|
| T |
45845516 |
gggctatgtgaacttggaaattgtccacaaacaacaggttgtggggtgttaagaggaacagcaaggcctaaagtaggtgcaaatatcaattt |
45845425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 876 times since January 2019
Visitors: 4356