View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_high_28 (Length: 242)
Name: NF0678_high_28
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0678_high_28 |
 |  |
|
| [»] chr2 (247 HSPs) |
 |  |
|
| [»] chr3 (331 HSPs) |
 |  |
|
| [»] chr8 (305 HSPs) |
 |  |
|
| [»] chr5 (290 HSPs) |
 |  |
|
| [»] chr4 (352 HSPs) |
 |  |
|
| [»] chr7 (279 HSPs) |
 |  |
|
| [»] chr1 (319 HSPs) |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |
|
| [»] chr6 (186 HSPs) |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |
|
| [»] scaffold0121 (3 HSPs) |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |
|
| [»] scaffold0009 (3 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |
|
| [»] scaffold0999 (1 HSPs) |
 |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |
|
| [»] scaffold0519 (1 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0257 (1 HSPs) |
 |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0264 (1 HSPs) |
 |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
| [»] scaffold0006 (2 HSPs) |
 |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |
|
| [»] scaffold0031 (2 HSPs) |
 |  |
|
| [»] scaffold1005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0517 (1 HSPs) |
 |  |  |
|
| [»] scaffold0083 (1 HSPs) |
 |  |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
| [»] scaffold0040 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 247)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 21 - 242
Target Start/End: Original strand, 3446626 - 3446847
Alignment:
| Q |
21 |
agaagaggacaagcatctaacactttgaaatcttgcttgagaaggttcaagtgactttgttgagagtcaaattaggattatttaacactctatttgaatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446626 |
agaagaggacaagcatctaacacttttaaatcttgcttgagaaggttcaagtgactttgttgagagtcaaattaggattatttaacactctatttgaatt |
3446725 |
T |
 |
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446726 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
3446825 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3446826 |
tgaactctagccactaggctac |
3446847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 4562828 - 4562704
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | | |
|
|
| T |
4562828 |
tttatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaatt |
4562729 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
4562728 |
gtgtgagctctagccactaggctac |
4562704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 33229007 - 33228885
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | ||| |
|
|
| T |
33229007 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgt |
33228908 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
33228907 |
gtgagctctagccactaggctac |
33228885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 4878205 - 4878326
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4878205 |
tatccccgtgagtttagctcacttggcagggatattgtatattatatgtaggggccagggttcgaaccccggacaccccacttctccacatttatatgtg |
4878304 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
4878305 |
tgagctctagccactaggctac |
4878326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 122 - 241
Target Start/End: Complemental strand, 18278490 - 18278370
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
18278490 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtg |
18278391 |
T |
 |
| Q |
221 |
tgaactctagccactaggcta |
241 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
18278390 |
tgagctctagccactaggcta |
18278370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 41509519 - 41509634
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
41509519 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
41509618 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41509619 |
ctagccactaggctac |
41509634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 4183173 - 4183294
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||||||| ||| | |||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccgaacactccacttctccacaattaaattgtg |
4183272 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4183273 |
tgaactctagccactaggctac |
4183294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 3287129 - 3287009
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
3287129 |
atccctgtgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaaccccggatactccacttctccacatttaattgtgt |
3287030 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| ||||||||||||| |||| |
|
|
| T |
3287029 |
gagctctagccactagactac |
3287009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 30390445 - 30390321
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatat |
217 |
Q |
| |
|
||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||| | |
|
|
| T |
30390445 |
tttatacccgtgaatttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacaccctacttctccacaatttaatt |
30390346 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||| |||||||||||| |
|
|
| T |
30390345 |
gtgtgagctctaaccactaggctac |
30390321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 2643692 - 2643815
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
2643692 |
ttatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattg |
2643791 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||| ||||| |
|
|
| T |
2643792 |
tgtgagctctagccactaagctac |
2643815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 6331557 - 6331679
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
6331557 |
ttatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccacttctccacaattaaattg |
6331655 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
6331656 |
tgtgagctctagccactaggctac |
6331679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 19281604 - 19281726
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
19281604 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgt |
19281703 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||| |||||||| |
|
|
| T |
19281704 |
gtgagctctagccattaggctac |
19281726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 40535523 - 40535401
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
40535523 |
tatccccgtgagcttagctcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgt |
40535424 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
40535423 |
gtgagctctagccactaggctac |
40535401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 1844826 - 1844935
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
1844826 |
ttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagcc |
1844925 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
1844926 |
actaggctac |
1844935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 20296415 - 20296536
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
20296415 |
atccccgtgagcttagctcagttgataaggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
20296514 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
20296515 |
tgagctctagccactaggctac |
20296536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 124 - 242
Target Start/End: Original strand, 5612953 - 5613072
Alignment:
| Q |
124 |
ccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtg |
222 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
5612953 |
ccctgtgagcttagctcagttggcagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccacttctccacaatttaattgtgtg |
5613052 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||| |||||||||||| |
|
|
| T |
5613053 |
agctctaaccactaggctac |
5613072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 36182645 - 36182760
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
36182645 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagcaggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
36182744 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
36182745 |
ctaaccactaggctac |
36182760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 44857301 - 44857186
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| ||||| | || |
|
|
| T |
44857301 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccacttctccataatttaattgtgtaagct |
44857202 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44857201 |
ctagccactaggctac |
44857186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 1071466 - 1071588
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
1071466 |
tatccccgtgagcttagctcagttggtatggatattgtatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
1071565 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
1071566 |
gtgtgctctagccactaggctac |
1071588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 17034727 - 17034853
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| || |||||||| ||||||||| ||||||||||||| ||| | |
|
|
| T |
17034727 |
aatttatccccgtgagcttagctcaattggtagggatattgcatattatatgcaggagtcggggttcgaatcccggacactccacttctccacaattaaa |
17034826 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
| ||||| |||||||||||||||||| |
|
|
| T |
17034827 |
ttatgtgagctctagccactaggctac |
17034853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 25857369 - 25857247
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||| |||||||||||| ||| | ||| |
|
|
| T |
25857369 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacaccggacactccacttctccacaattaacttgt |
25857270 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
25857269 |
gtgagctctagccactaggctac |
25857247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 34613982 - 34614096
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| | ||||||||||| ||| | ||||||| || |
|
|
| T |
34613982 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactctacttctccacaattaaattgtgtgagct |
34614081 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34614082 |
ctagccactaggcta |
34614096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 121 - 237
Target Start/End: Original strand, 3438944 - 3439061
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
3438944 |
tatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgt |
3439043 |
T |
 |
| Q |
220 |
gtgaactctagccactag |
237 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
3439044 |
gtgagctctagccactag |
3439061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 121 - 237
Target Start/End: Complemental strand, 22653718 - 22653601
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
22653718 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgt |
22653619 |
T |
 |
| Q |
220 |
gtgaactctagccactag |
237 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
22653618 |
atgagctctagccactag |
22653601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 127 - 232
Target Start/End: Complemental strand, 37352561 - 37352456
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||| |||||||| |||||||||||||||||||||| || |
|
|
| T |
37352561 |
tgtgagtttaactcagttggtagggatattgcatattatatgcaggggccgaagtttgaactccgaacaccccatttctccacatttatatgtgtgagct |
37352462 |
T |
 |
| Q |
227 |
ctagcc |
232 |
Q |
| |
|
|||||| |
|
|
| T |
37352461 |
ctagcc |
37352456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 44822417 - 44822542
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttata- |
216 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |||| |||||||||||||||| |||||||||||| ||||| |||||||||||| ||||| | |
|
|
| T |
44822417 |
tttatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggggttcgaaccccagacactccacttctccacaatttaaat |
44822516 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
44822517 |
tgtgtgagctctagccactaggctac |
44822542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 39408766 - 39408642
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||| ||||||||||||| ||| | | |
|
|
| T |
39408766 |
tttatccccgtgagcttaactcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccagacactccacttctccacaattaaatt |
39408667 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||| ||||| |
|
|
| T |
39408666 |
gtgtgagctctagccactatgctac |
39408642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 20919608 - 20919727
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||| | ||||| || |||| |||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
20919608 |
tccccgtgagcttagctcagttggtagggacattgcataatttatgctggggccggggttcgaaccccggacaccccacttctccacatttaattatgtg |
20919707 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
20919708 |
agctctagccactaggctac |
20919727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 5521294 - 5521172
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||| |||||| ||||| ||||| ||| |
|
|
| T |
5521294 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggggccgaggttcgaaccctggacactccacttttccacaatttaattgt |
5521195 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
5521194 |
gtgagttctagccactaggctac |
5521172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 17078449 - 17078575
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||| || |||||||| ||||||||| |||||||||||| ||| | |
|
|
| T |
17078449 |
aatttatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggagtcggggttcgaatcccggacacttcacttctccacaattaaa |
17078548 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
| ||||| |||||||||||||||||| |
|
|
| T |
17078549 |
ttttgtgagctctagccactaggctac |
17078575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 18694781 - 18694903
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||| | | |||||||| ||| ||||| ||||||||||||| ||| | ||| |
|
|
| T |
18694781 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaactggggttcgaatcccagacactccacttctccacaattaaattgt |
18694880 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
18694881 |
gtgagctctagccactaggctac |
18694903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 28153216 - 28153094
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||| ||| | ||| |
|
|
| T |
28153216 |
tatcccagtgagcttaactcagttggtagggatattgcatgttatatgcaggattcggggttcgaaccccggacaccccacttctccacaattaaattgt |
28153117 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||| |||| |
|
|
| T |
28153116 |
gtgagctctagccactagactac |
28153094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 36005434 - 36005560
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||| ||||| || |||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||| ||| | |
|
|
| T |
36005434 |
aatttatccccgtgagcgtaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaa |
36005533 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||| |||||||| |
|
|
| T |
36005534 |
ttgtgtgagctctagccaataggctac |
36005560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 19684070 - 19684190
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||| ||||||||||||| ||| | |||| |
|
|
| T |
19684070 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacccc-gacactccacttctccacaattaaattgtg |
19684168 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||| ||||||| |
|
|
| T |
19684169 |
tgagctctagccacaaggctac |
19684190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 129 - 241
Target Start/End: Original strand, 28194636 - 28194749
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||| ||| | ||||||| ||| |
|
|
| T |
28194636 |
tgagcttagctcagttgctagggatattgcatattatatgcaggggctggagttcgaaccccggacaccccacttctccacaattaaattgtgtgagctc |
28194735 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28194736 |
tagccactaggcta |
28194749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 38400307 - 38400432
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcagg----agccgaggttcgaaccccggacaccccacttctccacatttata- |
216 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| ||| | |
|
|
| T |
38400307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggccggggttcgaaccctggacaccccacttctccacaattaaat |
38400406 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
38400407 |
tgtgtgagctctagccactaggctac |
38400432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 120 - 238
Target Start/End: Complemental strand, 11050832 - 11050713
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| ||||||||||||||| || | ||||||||| |||||||||||||||||||| | ||| | || |
|
|
| T |
11050832 |
ttatccccgtgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaactccggacaccccacttctccataattaaattg |
11050733 |
T |
 |
| Q |
219 |
tgtgaactctagccactagg |
238 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
11050732 |
tgtgagctctagccactagg |
11050713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 233
Target Start/End: Complemental strand, 44898549 - 44898443
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||| | |||||||| || |
|
|
| T |
44898549 |
gtgaggttaactcagttggtaggaatattgcatattatatgcaggaaccgacgttcgaactccggacaccccacttctccacatttaaaatgtgtgagct |
44898450 |
T |
 |
| Q |
227 |
ctagcca |
233 |
Q |
| |
|
||||||| |
|
|
| T |
44898449 |
ctagcca |
44898443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 5474900 - 5475025
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca-ccccacttctccac-atttata |
216 |
Q |
| |
|
|||||||| ||||| ||||||||||||| ||||||||||||||||||| |||||||||| ||||||||| ||||||| |||||||||||||| ||| | |
|
|
| T |
5474900 |
tttatccccgtgagcttagctcagttggcagggatattgcatattatacgcaggagccggggttcgaactccggacacccccacttctccacaattcaat |
5474999 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||||| ||||| |
|
|
| T |
5475000 |
tgtgtgagctctagccactatgctac |
5475025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 126 - 242
Target Start/End: Complemental strand, 23919546 - 23919430
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaac |
225 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| |||||| ||| | || |||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
23919546 |
ctgtgagcttagctcagttggtagggacattgcataatatatggaggggtcggggttcgaatcccagacaccccatttctccacatttaattgtgtgaac |
23919447 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
23919446 |
tccagccactaggctac |
23919430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 28195201 - 28195094
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| | || | ||||| ||||||||| |||||||||||||| ||||| |||||||| ||| |
|
|
| T |
28195201 |
gtgagcttagctcagttggtagggatattgcatattatatgcaagggcaggggttctaaccccggataccccacttctccatattta-atgtgtgagctc |
28195103 |
T |
 |
| Q |
228 |
tagccacta |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
28195102 |
tagccacta |
28195094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 466680 - 466558
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||||||||| ||| || |||||||| ||||||||| ||| ||||||||| ||| | ||| |
|
|
| T |
466680 |
tatccccgtgagcatagctcagttggtagggatattacatattatatgcaagagtcggggttcgaaacccggacactccaattctccacaattaaattgt |
466581 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
466580 |
gtgaactctatccactaggctac |
466558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 121 - 237
Target Start/End: Complemental strand, 8250375 - 8250258
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||| ||| |||||||| ||| | ||| |
|
|
| T |
8250375 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacacttcacctctccacaattaaattgt |
8250276 |
T |
 |
| Q |
220 |
gtgaactctagccactag |
237 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
8250275 |
gtgagctctaaccactag |
8250258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 1309170 - 1309078
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
1309170 |
gatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctac |
1309078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 17089257 - 17089361
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || |||||||| ||||||||| ||||||||||||| ||| | | ||||| ||||||||||||| |
|
|
| T |
17089257 |
tcagttggtaggaatattgcatattatatgcaggagtcggggttcgaatcccggacactccacttctccacaattaaattatgtgagctctagccactag |
17089356 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
17089357 |
gctac |
17089361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 27297172 - 27297287
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||| ||||||||||| | | |||||||||||||||| ||||||||||| | ||| | |||| |
|
|
| T |
27297172 |
atccccgtgagcttagctcagttggtagggatattgcatattgtatgcaggagctgggattcgaaccccggacactccacttctccataattaaactgtg |
27297271 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| ||||||| |||| |
|
|
| T |
27297272 |
tgagctctagcgacta |
27297287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 7379673 - 7379559
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| ||| ||||||||||| |||||||||||||||||||||| | || |||||||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
7379673 |
atccccgtgagcttaactcagttggtaaggatattgcatattatatgcagaggtcggggttcgaattccgaacaccccatttctccacatttatatgtgt |
7379574 |
T |
 |
| Q |
222 |
gaactctagccacta |
236 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
7379573 |
gagttctagccacta |
7379559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 30932520 - 30932398
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||||||||||||||||||||||||| || ||| ||||| ||| |||| ||||||||||||| ||| | ||| |
|
|
| T |
30932520 |
tatccccgtgagcttacctcagttggtagggatattgcatattatatgcaggaggcggggtacgaacaccgcacactccacttctccacaattaaattgt |
30932421 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
30932420 |
atgagctctagccactagactac |
30932398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 119 - 201
Target Start/End: Complemental strand, 38179321 - 38179239
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| || | |||||||||| ||||||| |||| |
|
|
| T |
38179321 |
tttatccctgtgagtttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaacctcggacactccac |
38179239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 44948592 - 44948714
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||| |||||||| || ||||| ||| |
|
|
| T |
44948592 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagggaccggggttcgaaccctggacactgcacttctctacaatttaattgt |
44948691 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||| |||| |
|
|
| T |
44948692 |
gtgagttctagccactagactac |
44948714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 1260182 - 1260302
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| ||||||| |||| | | |||| ||| |||||||||||| |||||||||| ||| | |||| |
|
|
| T |
1260182 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgtaggatcgggggtttgaa-cccggacaccccgcttctccacaattaaattgtg |
1260280 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
1260281 |
tgagctctagccactaggctac |
1260302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 23984296 - 23984175
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| |||||||| |||||||||| | ||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
23984296 |
tccccgtgagcttagctcaattggtagggacaaatgcattttatatgcaggggccagggttcgaaccccggacaccccacttctccacatttaaaatgtg |
23984197 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||| ||||| |
|
|
| T |
23984196 |
tgaactccagccactaagctac |
23984175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 120 - 237
Target Start/End: Complemental strand, 33816491 - 33816374
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgt |
219 |
Q |
| |
|
||||||| || |||||| |||||||||||| |||||||||||||||||||||| | || | ||||||||||| |||||||| ||||| |||||||| ||| |
|
|
| T |
33816491 |
ttatccccgtcagtttacctcagttggtagagatattgcatattatatgcaggggtcgggtttcgaaccccgaacaccccatttctctacatttatctgt |
33816392 |
T |
 |
| Q |
220 |
gtgaactctagccactag |
237 |
Q |
| |
|
|||| || || ||||||| |
|
|
| T |
33816391 |
gtgagctttatccactag |
33816374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 40688700 - 40688591
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||| ||| |||||||||||||||||| | ||||||||||| ||| | ||||||| ||||| || |
|
|
| T |
40688700 |
ttagctcagttggtagagatattgcattttatatgcaggggccagggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctaacc |
40688601 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
40688600 |
actaggctac |
40688591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 141 - 237
Target Start/End: Complemental strand, 43616305 - 43616208
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| |||| ||||||||||| ||||||||| |||| |||| ||||| |||||||||||||||| |
|
|
| T |
43616305 |
agttggcagggatattgcatattatatgcaggggccgaagttcaaaccccggacatcccacttcttcacaattataatgtgcgaactctagccactag |
43616208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 15233410 - 15233530
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||||||| |||| |||| |||||| ||||| ||||||||| ||| ||| ||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcaggggccggagttcaaaccccagacactccacttctctacagttaattgtgt |
15233509 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| ||||||||||| ||||| |
|
|
| T |
15233510 |
gagttctagccactaagctac |
15233530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 41566760 - 41566880
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgt |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||||||||||||||||| | | ||||||| ||| ||||| |||||||||||| ||||| ||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggggttggagttcgaatcccagacactccacttctccacaatttaattgtgt |
41566859 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
41566860 |
gagctctagccactaggctac |
41566880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 146 - 241
Target Start/End: Complemental strand, 27463751 - 27463658
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||| || ||||| |||| ||||||||||| |
|
|
| T |
27463751 |
gtagggatattgcatattatatgcaggagccg-gggtcgaaccccggacaccccatttctccacattta-atatgtgagttctaaccactaggcta |
27463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 33041939 - 33041820
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |||||| |||| ||| | | |
|
|
| T |
33041939 |
tttatccccgtgagtttaactcagttggtagggatattgcatattatatgcaaaggccagggttcgaaccccgaacaccctacttcttcacaattaaatt |
33041840 |
T |
 |
| Q |
218 |
gtgtgaactctagccactag |
237 |
Q |
| |
|
|||||| ||||| ||||||| |
|
|
| T |
33041839 |
gtgtgagctctaaccactag |
33041820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 136 - 242
Target Start/End: Original strand, 34355732 - 34355839
Alignment:
| Q |
136 |
agctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| |||||||||||| ||||| |||||||||||| ||||| ||| ||| ||||| |||| |
|
|
| T |
34355732 |
agctcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccagacactccacttctccacaatttaattgtatgagctctaaccac |
34355831 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|| ||||| |
|
|
| T |
34355832 |
taagctac |
34355839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 125 - 224
Target Start/End: Original strand, 44558003 - 44558101
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaa |
224 |
Q |
| |
|
|||||||||||| ||||||||||||| | |||||||| | |||||||| || | |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44558003 |
cctgtgagtttaactcagttggtagg-acattgcataatttatgcaggggctggggttcgaaccccggacaccccacttctccacatttaattgtgtgaa |
44558101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 208
Target Start/End: Original strand, 1500970 - 1501044
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || | |||||||||||| ||||| ||||||||||| |
|
|
| T |
1500970 |
ttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctcca |
1501044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 2289606 - 2289728
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||||||||||||||||| | | ||||||||||| |||||| || ||||||||| ||||| ||| |
|
|
| T |
2289606 |
tatccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggggtcagggttcgaaccctggacactccccttctccacaatttaattgt |
2289705 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||| |||||||||||| |
|
|
| T |
2289706 |
gtgagttctaaccactaggctac |
2289728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 206
Target Start/End: Complemental strand, 7281755 - 7281678
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
7281755 |
gtgagttaagctcagttggtagggatattgcatattatatgcaggggccga-gttcgaatcccggacactccacttctc |
7281678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 129 - 238
Target Start/End: Complemental strand, 16385108 - 16384998
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| |||||||||| ||| ||||||||| |||||||| ||||||||||||| ||| | ||||||| ||| |
|
|
| T |
16385108 |
tgagcttagctcagttggtatggatattgcattttatatgcagagaccggggttcgaactccggacactccacttctccacaattaaattgtgtgagctc |
16385009 |
T |
 |
| Q |
228 |
tagccactagg |
238 |
Q |
| |
|
||||||||||| |
|
|
| T |
16385008 |
tagccactagg |
16384998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 30392898 - 30392784
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||| || |||||||||||| ||||| |||||| | |||| ||| | ||||||| ||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatgtaggagtcggggttcgaaccccagacactccacttgttcacaattaaattgtgtgagctc |
30392799 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| ||||||| |||| |
|
|
| T |
30392798 |
taaccactagactac |
30392784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 31223624 - 31223738
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||| || | |||| ||||||| ||||| |||||||||||| ||||| ||||||| || |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatgcaggggctggggtttgaaccccagacactccacttctccacaatttaattgtgtgagctt |
31223723 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
31223724 |
tagctactaggctac |
31223738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 32609254 - 32609172
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||| ||| || ||||||||| |||||||| ||||||||||||| |
|
|
| T |
32609254 |
gtgagcttaactcagttggtagggatattgcatattatatgcaagagtcggggttcgaactccggacactccacttctccaca |
32609172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 130 - 223
Target Start/End: Original strand, 2132721 - 2132814
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||||||||||| ||||||||| |||||||| | |||||||||||||| ||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2132721 |
gagtttagctcaactggtagggacattgcataatttatgcaggagccgaagttcgaattccgaacaccccgcttctccacatttatatgtgtga |
2132814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 2145796 - 2145687
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtgtgaactctagcc |
232 |
Q |
| |
|
|||| |||||||||||||| |||||||| | |||||||| || |||||| ||| ||| |||||||||||||||||||||||| | |||||| ||| |||| |
|
|
| T |
2145796 |
ttagttcagttggtagggacattgcataatttatgcaggggcagaggtttgaatccctgacaccccacttctccacatttataacgtgtgagctccagcc |
2145697 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
2145696 |
actaggctac |
2145687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 17777235 - 17777115
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||||||| || |||||| |||||| ||| |||||| |||||||||||||| | || ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
17777235 |
atccctgtaaggttagcttagttggcagg-atattgtatattatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
17777137 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|| | ||| |||||||||||| |
|
|
| T |
17777136 |
cgagccctatccactaggctac |
17777115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 120 - 209
Target Start/End: Original strand, 18803206 - 18803295
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
||||||| ||||| |||||||| |||||||| ||||||||||||||||||| |||||| ||||||||||| |||||| | |||||||||| |
|
|
| T |
18803206 |
ttatccccgtgagcttagctcacttggtaggaatattgcatattatatgcaagagccggggttcgaaccctggacactctacttctccac |
18803295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 22718134 - 22718014
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||| || ||||||||||||||||| | ||||||||||||| |||| ||||||||||||| ||| || ||| |
|
|
| T |
22718134 |
atccccgtgagcttaactcagttggtagggatactgtatattatatgcaggagctggggttcgaaccccgaacactccacttctccacaattaaatcgtg |
22718035 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| | |||||||||| |
|
|
| T |
22718034 |
tgagctcta-caactaggctac |
22718014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 28692546 - 28692437
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||| |||| ||||||||||||||| ||||||||||| | || ||||||||||| |||||| |||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
28692546 |
ttagcttagtttgtagggatattgcattttatatgcaggggtcggggttcgaacccaggacactccacttctccacaatttaattgtgtgagctctagcc |
28692447 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
| |||||||| |
|
|
| T |
28692446 |
agtaggctac |
28692437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 230
Target Start/End: Original strand, 33262439 - 33262548
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| |||| ||||||||||| | || |||||||||| ||||||| ||||||||||||| ||| | |||| |
|
|
| T |
33262439 |
atccccgtgagtttagctcagctggtagggatatcgcattttatatgcaggggtcggggttcgaacctcggacactccacttctccacaattaaattgtg |
33262538 |
T |
 |
| Q |
221 |
tgaactctag |
230 |
Q |
| |
|
|||| ||||| |
|
|
| T |
33262539 |
tgaattctag |
33262548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 128 - 237
Target Start/End: Complemental strand, 40363138 - 40363029
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||| ||| | || |||||||||||| ||||| | ||||||||| ||||| ||||||| ||| |
|
|
| T |
40363138 |
gtgagcttaactcagttggtagggatattgcatattatatgtaggggtcggggttcgaacccccgacactctacttctccatatttaattgtgtgagctc |
40363039 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|| ||||||| |
|
|
| T |
40363038 |
taaccactag |
40363029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 40473623 - 40473506
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||| ||||||||| ||||||||||| || | |||| ||||| ||||||||||||||||||||| ||| | |||| |
|
|
| T |
40473623 |
atccccgtgagcttaactcagttggtagaaatattgcatgttatatgcaggggctggggtttgaacctcggacaccccacttctccacaattaaattgtg |
40473524 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
40473523 |
tgagctctagccactagg |
40473506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 4659417 - 4659525
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||| ||||||| || | |||||| ||||||||| ||| || | ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4659417 |
ttagttcagttgctatgaatattgtatattatatataggggctggggttcgaactccggacaccccacttctccacatttatatgtgtgagctctagcca |
4659516 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||| |||| |
|
|
| T |
4659517 |
ttagactac |
4659525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 17487713 - 17487789
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||| |||||||||||| |
|
|
| T |
17487713 |
ttagctcagttggtagggatattgcatattatatgcagtggctggggttcgaaccccggacacttcacttctccaca |
17487789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 196
Target Start/End: Complemental strand, 6636041 - 6635966
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
6636041 |
tatctctgtgagcttagctcagttggtagggatattgcatattatatgcagggacgggggttcgaaccccggacac |
6635966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 8742891 - 8742776
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||| |||||| ||||||||||| ||| || | ||||||||||||| |||| |||||| | ||| ||||| |||||||||| |
|
|
| T |
8742891 |
gtgagcttagctcagttggtagagatattacatattatatgtaggggctggggttcgaaccccgcacactccactttttcacaatttaattgtgtgaact |
8742792 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
8742791 |
ctagccactagactac |
8742776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 238
Target Start/End: Complemental strand, 11093855 - 11093744
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||| || |||||||||| |||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
11093855 |
gtgagcttaactcatttagtagggatatcgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
11093756 |
T |
 |
| Q |
227 |
ctagccactagg |
238 |
Q |
| |
|
||| ||| |||| |
|
|
| T |
11093755 |
ctaaccattagg |
11093744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 13606310 - 13606196
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||| | |||||||| ||||||||| |||||||||||||||| ||| | ||||||| || |
|
|
| T |
13606310 |
gtgagcttagctcagttggtagggatattaagtattatatgcaggggtcgaggttcaaaccccgga-accccacttctccacaattaaattgtgtgagct |
13606212 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||| ||||| |
|
|
| T |
13606211 |
ctaaccactaagctac |
13606196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 140 - 242
Target Start/End: Complemental strand, 29772333 - 29772230
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| || || | |||||||||||| ||||| ||| |||||||| ||||| ||||||| |||||||||||||| |
|
|
| T |
29772333 |
cagttggtagggatattgcatattatatgtcggggctggggttcgaaccccagacactccaattctccacaatttaattgtgtgagctctagccactagg |
29772234 |
T |
 |
| Q |
239 |
ctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
29772233 |
ctac |
29772230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 29942202 - 29942079
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatg |
218 |
Q |
| |
|
||||||| |||||| ||| ||||||| |||||||||||||||||||||||||| || | |||||||| | |||||| ||||||||||| ||||| || |
|
|
| T |
29942202 |
tttatccatgtgagcttaactcagttagtagggatattgcatattatatgcagaggcgggggttcgaattctggacactccacttctccatatttaattg |
29942103 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||| ||||| |||| |
|
|
| T |
29942102 |
tgtgagctctagcaactagactac |
29942079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 134 - 236
Target Start/End: Original strand, 3596259 - 3596361
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||| |||||| || || |||||||| | |||||||| | || |||||||||||||||||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
3596259 |
ttagcttagttggcagagacattgcataatttatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaattgtgtgagctccagcca |
3596358 |
T |
 |
| Q |
234 |
cta |
236 |
Q |
| |
|
||| |
|
|
| T |
3596359 |
cta |
3596361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 28646970 - 28646865
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacat-ttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||| |||| ||||||||||||||||| ||||||| |||| |||||||||||| ||| ||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
28646970 |
tagctaagtttgtagggatattgcatat---atgcaggggccggggttcgaaccccagaccccctacttctccacatattatatgtgtgagctctagcca |
28646874 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
28646873 |
ctagactac |
28646865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 29449452 - 29449566
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||| ||| ||||||||||| |||| |||||||||||| ||||| | ||||||||||| ||| | ||||||| ||| |
|
|
| T |
29449452 |
tgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccagacactctacttctccacaattaaattgtgtgagctc |
29449551 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||| ||| |||| |
|
|
| T |
29449552 |
tagccattagactac |
29449566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 32854540 - 32854650
Alignment:
| Q |
134 |
ttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagc |
231 |
Q |
| |
|
|||| ||| |||||||||||| ||||| ||||||||| | |||| |||||||||||||||||||| |||||||||||||| | |||||||| ||| ||| |
|
|
| T |
32854540 |
ttagttcaattggtagggataaatgcattttatatgcaagggccggggttcgaaccccggacaccctacttctccacatttaaaatgtgtgagctccagc |
32854639 |
T |
 |
| Q |
232 |
cactaggctac |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
32854640 |
cactaggctac |
32854650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 120 - 206
Target Start/End: Original strand, 33669731 - 33669817
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||||| ||||| ||| ||||||| ||||||||||||||||||||||| ||| ||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
33669731 |
ttatccccgtgagcttaactcagttagtagggatattgcatattatatgtaggggccgatgttcgaaccccagacactccacttctc |
33669817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 120 - 210
Target Start/End: Original strand, 35367406 - 35367496
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| |||| |||||||||||| || ||||||||||||||||| || | |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35367406 |
ttatccccatgagcttagctcagttgataatgatattgcatattatatacaagggccgaggttcgaaccccggacaccccacttatccaca |
35367496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 40864402 - 40864484
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| ||||||||||| |||| ||||||||| |||||||| ||| ||||||||| |
|
|
| T |
40864402 |
gtgagcttagctcagttggtaggaatattgcattttatatgcaggggccggggttcgaacaccggacactccaattctccaca |
40864484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 141 - 234
Target Start/End: Original strand, 44186459 - 44186553
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || | |||||||||| ||||||||||||||||||||| ||| | ||||||| |||||||||| |
|
|
| T |
44186459 |
agttggtagggatattacatattatatgcagcggctgtggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccac |
44186553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 232
Target Start/End: Original strand, 3301814 - 3301919
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| |||||| |||| | || ||||||||||||| |||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
3301814 |
gtgagcttagctcatttggtagggatattgcattttatatacaggggtcggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagct |
3301913 |
T |
 |
| Q |
227 |
ctagcc |
232 |
Q |
| |
|
|||||| |
|
|
| T |
3301914 |
ctagcc |
3301919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 11144288 - 11144167
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||| || ||| | |||||||||| |||| |||||||||||||||| | | |||| |
|
|
| T |
11144288 |
tatccccgtgagtttagctcagttggtagaaatattgcatattatgtgtagggattgtggttcgaacctcggataccccacttctccacaataaattgtg |
11144189 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
| | |||||||||||||||||| |
|
|
| T |
11144188 |
ttagctctagccactaggctac |
11144167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 38525626 - 38525509
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||||||||| ||||||||||| | | ||||||||||| | |||| ||||||||||||| ||| | |||| |
|
|
| T |
38525626 |
atccccgtgagcttagctcagttggtaaggatattgcattttatatgcaggggtcagggttcgaacccggaacactccacttctccacaattaaattgtg |
38525527 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| ||||||||| |||| |
|
|
| T |
38525526 |
tgagctctagccattagg |
38525509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 43895910 - 43896031
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| ||| ||||||||| | |||| |||| |||||| |||||| ||||||||| ||| ||| | |||| |
|
|
| T |
43895910 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgcaagggccggggtttgaaccctggacactccacttctctacaattaaattgtg |
43896009 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
43896010 |
tgagctctagccactagactac |
43896031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 121 - 210
Target Start/End: Original strand, 44021070 - 44021158
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||| ||||||||| |||||| ||||| | | |||||||||||||||||||||||||||||||| |
|
|
| T |
44021070 |
tatccccgtgagcttaactcagttggtaggaatattgcatgttatatacaggatcgg-ggttcgaaccccggacaccccacttctccaca |
44021158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 237
Target Start/End: Complemental strand, 44666410 - 44666301
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||| || ||||||||||||||||| ||||||||||||| ||| ||||||| ||| |
|
|
| T |
44666410 |
gtgagtttagctcaattgacagggatattgcataatatatgcagggatcggggttcgaaccccggacattccacttctccacaattaattgtgtgagctc |
44666311 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|| ||||||| |
|
|
| T |
44666310 |
taaccactag |
44666301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 215
Target Start/End: Complemental strand, 11950068 - 11949976
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat |
215 |
Q |
| |
|
|||| ||||| |||||| ||||||||| || ||| || | | |||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11950068 |
tccccgtgagcttagctaagttggtagagaaattacacaatttatgcaggggacgaggttcgaaccccggacaccccacttctccacatttat |
11949976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 23405194 - 23405274
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||| |||||||||| | || ||||||||||| ||||||||||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcaggggtcggggttcgaaccctggacaccccactt |
23405274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 32190063 - 32189955
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||| |||||||||||||| |||||||| | |||||||| |||| ||||||||||||||||||| ||||| || ||| ||| ||||||| |||||| || |
|
|
| T |
32190063 |
ttagttcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcacttttctacaattaattgtgtgagctctagtca |
32189964 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
32189963 |
ttaggctac |
32189955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 43214354 - 43214471
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||| | |||| ||| || |||||||||| || |||||| ||||||||||| |||| |||||| |
|
|
| T |
43214354 |
tccccgtgagcttaactcagttggtagggatattgcataatttatgtaggggctgaggttcgaa--ccagacacctcacttctccacgtttaattgtgtg |
43214451 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||| |||||||||||| |
|
|
| T |
43214452 |
agctctaaccactaggctac |
43214471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 156 - 242
Target Start/End: Original strand, 5947897 - 5947984
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||| | || |||||||||||||||||||||||| |||||||||| | |||||||| ||| |||||||||||||| |
|
|
| T |
5947897 |
tgcattttatatgcaggggtcggggttcgaaccccggacaccccactcctccacatttaaaatgtgtgagctccagccactaggctac |
5947984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 9330568 - 9330453
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||| ||| |||||||||||||||||||||| || ||||| ||||| |||||||| |||||| |||||| ||| | ||||||| || |
|
|
| T |
9330568 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggggctgaggtgcgaactccggacactccacttatccacaattaaattgtgtgagct |
9330469 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
9330468 |
atagccactagtctac |
9330453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 15764933 - 15765048
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||| ||| |||||| |||||||| ||| ||| | || |||| | |
|
|
| T |
15764933 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaatcccagacacctcacttctctacaattaaattgcgtgagcc |
15765032 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15765033 |
atagccactaggctac |
15765048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 27913536 - 27913422
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||| | | ||||||||||| ||||| |||||||||||| ||||| ||||| | || |
|
|
| T |
27913536 |
gtgagcttagctcaattggtagggatattgcatattatatgcagg-gttggggttcgaaccctagacactccacttctccacaatttaattgtgtaagct |
27913438 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
27913437 |
ctaaccactaggctac |
27913422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 41246384 - 41246501
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| |||||||||||| ||||| |||| ||| | |||| | | |||| |||||||||||||||||||||||||||| ||||||| || |||| |
|
|
| T |
41246384 |
tccccgtgagcttagctcagttgacagggacattgtatagtttatgtaagggccggggttcgaaccccggacaccccacttctctacattta-at-tgtg |
41246481 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
41246482 |
aactctagccactagactac |
41246501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 8322810 - 8322924
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||| |||| ||||||||||||| ||||||||||||||| |||| | || ||||||||||| ||||| ||||||||||||| ||||| ||| ||| || |
|
|
| T |
8322810 |
tgagcttagttcagttggtaggggtattgcatattatatacaggggtcggggttcgaaccctggacatcccacttctccacaatttaattgtatgagttc |
8322909 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
8322910 |
taaccactaggctac |
8322924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 146 - 242
Target Start/End: Original strand, 18862275 - 18862370
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| ||||| ||| || | |||||||||||| ||||| |||||||||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
18862275 |
gtagggatattgcata--atatgtaggggcaggggttcgaacccccgacactccacttctccacatttaaaatgtgtgagctctagccactaggctac |
18862370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 27497603 - 27497481
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgt |
219 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| ||||||||| | || | ||| ||||| | |||||||||||||||||||||| | | |
|
|
| T |
27497603 |
ttatccccgtgagcatagctcagttggtagggatattgcatgttatatgcaagggctggagtttgaacctcaaacaccccacttctccacatttaattat |
27497504 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| ||||||| |||| |
|
|
| T |
27497503 |
gtgagctctaaccactagcctac |
27497481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 33587093 - 33587207
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactc |
227 |
Q |
| |
|
|||||||| || |||||||| | | ||||||||||||||| ||| | |||||||| |||||||||||||||||||||||| |||| | || ||||| ||| |
|
|
| T |
33587093 |
tgagtttaacttagttggtatgaaaattgcatattatatgtaggggtcgaggttcaaaccccggacaccccacttctccatatttaaaatatgtgagctc |
33587192 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||| |||||| |||| |
|
|
| T |
33587193 |
tagtcactagactac |
33587207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 117 - 242
Target Start/End: Complemental strand, 35798104 - 35797978
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||| ||||| ||| |||||||| ||| |||||||||||||||||||||| | | |||||||| || ||| || ||||||||| ||| ||| | |
|
|
| T |
35798104 |
aatttatccccgtgagcttaactcagttgttagagatattgcatattatatgcaggggttggggttcgaaacctggatactccacttctctacaattaaa |
35798005 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||| |||||||||||||| |
|
|
| T |
35798004 |
ttgtgtgagctccagccactaggctac |
35797978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 38557297 - 38557175
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||| |||| ||||||||||| | || |||||||||||||||||| ||||| || ||| ||| | ||| |
|
|
| T |
38557297 |
tatccccgtgagcttaactcagttggtagggatatggcattttatatgcaggggtcggggttcgaaccccggacacttcacttatctacaattaaattgt |
38557198 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||| ||| |||| |
|
|
| T |
38557197 |
gtgagctctagccattagactac |
38557175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 120 - 223
Target Start/End: Original strand, 43146347 - 43146454
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccga----ggttcgaaccccggacaccccacttctccacatttat |
215 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| | |||||||| | || ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
43146347 |
ttatccccgtgagtttaactcagttggtagggatattgcataatttatgcagggactgacccgggttctaaccccgaacaccccacttctccacatttaa |
43146446 |
T |
 |
| Q |
216 |
atgtgtga |
223 |
Q |
| |
|
||||||| |
|
|
| T |
43146447 |
ttgtgtga |
43146454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 14663987 - 14664095
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| | |||||||| ||| |||| ||||||||||| |||||||||||||| ||| ||||||| ||| |
|
|
| T |
14663987 |
gtgagtttagttcagttggtagggacattgcataatttatgcaggggccagagttcaaaccccggaca-cccacttctccacaattaattgtgtgagctc |
14664085 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||| ||||| |
|
|
| T |
14664086 |
tagctactag |
14664095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 238
Target Start/End: Original strand, 18254586 - 18254703
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||||| ||||| ||||||||||| |||| ||||||||| || |||||||||||||| ||||||| | ||||| |
|
|
| T |
18254586 |
tcccagtgagcttaactcagttggtagggataaatgcattttatatgcaggggccggggttcgaactccagacaccccacttcttcacatttaaaatgtg |
18254685 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| ||| | |||||||| |
|
|
| T |
18254686 |
tgagctccaaccactagg |
18254703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 201
Target Start/End: Original strand, 19612718 - 19612791
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |||||| | |||||||||||| ||||| |||| |
|
|
| T |
19612718 |
gtgagcttagttcagttggtagggatattgcatattatatgtaggagctggggttcgaaccccagacactccac |
19612791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 20497268 - 20497147
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||| ||| || | |||||||| |||||||||||||||||||||||||| | ||||| |
|
|
| T |
20497268 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgtaggggctggggttcgaatcccggacaccccacttctccacatttaaaatgtg |
20497169 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||| ||||||||| |
|
|
| T |
20497168 |
tgagctccagcctctaggctac |
20497147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 223
Target Start/End: Original strand, 25932545 - 25932634
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| | || || |||||||| || ||||||||||| ||||||||| | |||||||| |
|
|
| T |
25932545 |
ttagctcagttggtagggatattgtatattaaatgcaagggctgacgttcgaactccagacaccccactactccacattaaaatgtgtga |
25932634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 33549128 - 33549039
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||| |||||||||||| ||| ||||||| ||||||||||||||||| | |||||||||||| |||| |||||||||||| |
|
|
| T |
33549128 |
tatccccgtgagcttagctcagttgatagagatattgtatattatatgcaggagctggggttcgaaccccaaacacttcacttctccaca |
33549039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 147 - 242
Target Start/End: Original strand, 11189950 - 11190046
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||| ||||||||||| | || || ||||||||| |||| |||||||||||||| ||| | ||||||| ||||||||| |||||||| |
|
|
| T |
11189950 |
tagggatattgcatgttatatgcaggggtcgggggtcgaaccccagacatcccacttctccacaattaaattgtgtgagctctagccattaggctac |
11190046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 13242792 - 13242684
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||| ||||||| ||| ||||||||||| | |||||||| | || |||||||||| |||||||| |||||||||||||||| ||||||| || || || |
|
|
| T |
13242792 |
ttagatcagttgatagagatattgcataatttatgcaggggtcggggttcgaacctcggacacctcacttctccacatttaattgtgtgagatccagtca |
13242693 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
13242692 |
ctaggctac |
13242684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 13773434 - 13773518
Alignment:
| Q |
159 |
atattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||||| ||||||||||||| ||| | ||||||| ||||| |||||||||||| |
|
|
| T |
13773434 |
atattatatgtaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaaccactaggctac |
13773518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 27449193 - 27449301
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | | || |||||||||| ||| || ||||||| ||||| ||| | ||||||| ||||||||| |
|
|
| T |
27449193 |
tagctcagttggtagggatattgcattttatatgcatgggtcggggttcgaaccttggatactccacttcaccacaattaaattgtgtgagctctagcca |
27449292 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
27449293 |
ataggctac |
27449301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 241
Target Start/End: Original strand, 32220964 - 32221086
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt---atatg |
218 |
Q |
| |
|
|||| ||||| || ||||||||||| |||| | ||||| ||||||||||| |||| |||||||||| |||||||||||||| ||||||||| | ||| |
|
|
| T |
32220964 |
tccccgtgagctttgctcagttggttgggacaaatgcattttatatgcaggggccggggttcgaacctcggacaccccacttttccacatttaaaaaatg |
32221063 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||| ||| ||||||||||||| |
|
|
| T |
32221064 |
tgtgagctccagccactaggcta |
32221086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 33233295 - 33233168
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcagga----------gccgaggttcgaaccccggacaccccacttctccacat |
211 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcggggttcgccggggttcgaactccggacactccacttctccacaa |
33233196 |
T |
 |
| Q |
212 |
ttata-tgtgtgaactctagccactagg |
238 |
Q |
| |
|
||| | ||||||| ||||||||||||| |
|
|
| T |
33233195 |
ttaaattgtgtgagttctagccactagg |
33233168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 237
Target Start/End: Original strand, 1964362 - 1964465
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||| | |||| ||||| |||||||| | |||||||| |||| ||||| |||||||||||||||||||||||| ||||| ||||||| || | |||| |
|
|
| T |
1964362 |
ttagcttaattggcagggacattgcataatttatgcaggggccggggttcaaaccccggacaccccacttctccatatttaattgtgtgagctattgcca |
1964461 |
T |
 |
| Q |
234 |
ctag |
237 |
Q |
| |
|
|||| |
|
|
| T |
1964462 |
ctag |
1964465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 148 - 242
Target Start/End: Original strand, 2305094 - 2305189
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| ||| | |||||| |||||||||||| ||||| ||||||| |||||||| |||||||| |
|
|
| T |
2305094 |
agggatattgcatattatatgcaggggccggggttcaaactctggacactccacttctccacaatttaattgtgtgagttctagccattaggctac |
2305189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 127 - 202
Target Start/End: Original strand, 8702575 - 8702649
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| ||||||||| |||||||| || ||||||| |
|
|
| T |
8702575 |
tgtgagtttagctcatctgatagggatattgcatattatatgcagg-gccgaggtttgaaccccgaactccccact |
8702649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 127 - 202
Target Start/End: Original strand, 8732231 - 8732305
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| ||||||||| |||||||| || ||||||| |
|
|
| T |
8732231 |
tgtgagtttagctcatctgatagggatattgcatattatatgcagg-gccgaggtttgaaccccgaactccccact |
8732305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 138 - 241
Target Start/End: Complemental strand, 20898110 - 20898007
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| || ||||||||||| || ||| | ||||||| ||||| |||| | ||||| ||||| ||||||| |
|
|
| T |
20898110 |
ctcagttggtaggggtattgcatattttatgcagaggcggaggttcgaactcctgacgctccacttccccacacttatttatgtgagctctaaccactag |
20898011 |
T |
 |
| Q |
238 |
gcta |
241 |
Q |
| |
|
|||| |
|
|
| T |
20898010 |
gcta |
20898007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 126 - 242
Target Start/End: Original strand, 32168929 - 32169049
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc----ccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||| || | | || ||||||| |||||||||||||||||| || |||| ||||| |
|
|
| T |
32168929 |
ctgtgagcttaactcagttggtagggatattgcatattatatgtagaggatggggctcgaaccccggccggacaccccacttctcaacgtttaattgtgt |
32169028 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| ||||||| |||||||||| |
|
|
| T |
32169029 |
gagctctagctactaggctac |
32169049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 138 - 201
Target Start/End: Original strand, 37063533 - 37063596
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||| |||| |
|
|
| T |
37063533 |
ctcagttggtagggatattgcatattatatgcaggggccagggttcgaactccggacactccac |
37063596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 200
Target Start/End: Complemental strand, 5398180 - 5398102
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||| || | |||||||||||| ||||||||| |
|
|
| T |
5398180 |
atccctgtgaacttagctcagttggtagggatattacattttatatgcagaggctggggttcgaaccccagacacccca |
5398102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 27016280 - 27016362
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||| |||||||||| |||||||||||||||||| |||| | || |||||||||| |||||| ||||||||||||| |
|
|
| T |
27016280 |
gtgagcttagttcagttggtatggatattgcatattatatacaggggtcggagttcgaaccctggacactccacttctccaca |
27016362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 27082324 - 27082438
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||||| |||| ||||||| || |||||| |||||||||||| ||||| ||||||| ||| |
|
|
| T |
27082324 |
tgagcttagctcagttagtagggatattatatattatatgcaggggccggagttcgaaacctggacactccacttctccacaatttaattgtgtgagctc |
27082423 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| ||| ||||||| |
|
|
| T |
27082424 |
taaacaccaggctac |
27082438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 201
Target Start/End: Original strand, 38387677 - 38387739
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | |||||||||||| ||||| |||| |
|
|
| T |
38387677 |
tcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccac |
38387739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 119 - 208
Target Start/End: Original strand, 1232186 - 1232275
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||| ||||| ||| ||||||||||| |||||| ||| ||||||||||| | |||||||||| ||||||||| ||||||||||| |
|
|
| T |
1232186 |
tttatccccgtgagcttaactcagttggtaaggatatcacattttatatgcaggggttgaggttcgaatcccggacactccacttctcca |
1232275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 118 - 199
Target Start/End: Complemental strand, 2806578 - 2806498
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacccc |
199 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||||||| |||||||||| ||| | || |||||||||||| |||||||| |
|
|
| T |
2806578 |
atttattcccgtgagcttagctcagttggtagggatattgtatattatatgtaggggtcg-ggttcgaaccccagacacccc |
2806498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 16040244 - 16040353
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| |||| |||||| | | |||| |||| ||||||| |||||||||||||| ||| | ||||||| || |
|
|
| T |
16040244 |
gtgagcttagttcagttggtagggatattgcatgttatttgcaggggttggggtttgaactccggacatcccacttctccacaattaaattgtgtgagct |
16040343 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
||| |||||| |
|
|
| T |
16040344 |
ctaaccacta |
16040353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 170 - 242
Target Start/End: Original strand, 17498994 - 17499067
Alignment:
| Q |
170 |
aggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
17498994 |
aggagccggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagccactaggctac |
17499067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 17601092 - 17601197
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| | || ||||||||| |||||| |||||||||||| ||||| | ||||| ||||| |||||| |
|
|
| T |
17601092 |
ctcagttggtagggatattgcatatcatatgcaggggtcggagttcgaaccatggacactccacttctccacaatttaattatgtgagctctaaccacta |
17601191 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
17601192 |
cgctac |
17601197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 138 - 235
Target Start/End: Complemental strand, 24581521 - 24581424
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| || | |||||| | |||| ||||| |||||||||||| ||| ||||||| | ||||||||| |
|
|
| T |
24581521 |
ctcagttggcagggatattgcataatatatgcaggggctggggttcgtatcccgaacacctcacttctccacaattaattgtgtgagcactagccact |
24581424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 25093470 - 25093549
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatat---tatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||||||||||||| |||||||| ||||||||| |||||| |||||| |
|
|
| T |
25093470 |
ttagctcagctgatagggatattgcatataattatatgcaggagccggggttcgaatcccggacactccacttttccaca |
25093549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 128 - 197
Target Start/End: Original strand, 28771582 - 28771651
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
||||||||||||||||||||| ||| | |||||| |||||||| || ||| ||||||||||||||||||| |
|
|
| T |
28771582 |
gtgagtttagctcagttggtaaggacaatgcataatatatgcaagatccgcggttcgaaccccggacacc |
28771651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 42199947 - 42199862
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||| | | |||||||||| || |||||| ||||||| ||||||| |
|
|
| T |
42199947 |
tgagtttaactcagttggtagggatattgcatattatatacagagactgtggttcgaacctcgtacaccctacttctctacattta |
42199862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 5112906 - 5112803
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| ||| |||||||| || ||| | |||||||||||||| ||| | ||||||| ||||| ||||||| |
|
|
| T |
5112906 |
tcagttggtagg-atattgcatatgatatgcaggggccacggttcgaatcctggatatcccacttctccacaattaaattgtgtgagctctaaccactag |
5112808 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
5112807 |
gctac |
5112803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 15939343 - 15939407
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | |||||||| ||| |||||||||||||| |
|
|
| T |
15939343 |
ggttcgaaccccgaacaccccacttctccacatttaaaatgtgtgagctccagccactaggctac |
15939407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 233
Target Start/End: Complemental strand, 33222211 - 33222115
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | || |||| |||| ||||||||||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
33222211 |
ctcagttggtagggatattgcatattatatgtatggatcggcgttcaaacctcggacaccccacttctccacaattaaactgtgtgagctctagcca |
33222115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 210
Target Start/End: Complemental strand, 33563266 - 33563195
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| | || |||||||||||| ||||| ||||||||||||| |
|
|
| T |
33563266 |
ctcagttggtagggatattgtattttatatgcaggggtcg-ggttcgaaccccagacactccacttctccaca |
33563195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 154 - 241
Target Start/End: Original strand, 3154026 - 3154113
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||||| | |||||||| ||| ||||||||||| |||||| |||||||||| |||||| ||||||| ||||||||||| ||||| |
|
|
| T |
3154026 |
attgcataatttatgcagggaccggggttcgaaccctggacactccacttctcctcatttaattgtgtgacctctagccactgggcta |
3154113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 188
Target Start/End: Original strand, 15485658 - 15485725
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
188 |
Q |
| |
|
|||||| ||||| ||||||||||||||| |||||||||||||||||||| ||||| | |||| ||||| |
|
|
| T |
15485658 |
tatccccgtgagcttagctcagttggtaaggatattgcatattatatgctggagcaggggtttgaacc |
15485725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 237
Target Start/End: Original strand, 13975149 - 13975239
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||||||| ||||||||||| | || |||||||| |||||||||||| |||| |||| ||| | ||||||| ||||||||||||| |
|
|
| T |
13975149 |
agggatattgcatgttatatgcaggggtcggagttcgaactccggacaccccatttcttcacaattaaattgtgtgagctctagccactag |
13975239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 36748890 - 36748975
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||||||| ||||||| | || ||||||||| || |||| ||||||||||||||||| |
|
|
| T |
36748890 |
gtgagcttaactcagttggtagggacattgcatatta-atgcaggggtcggggttcgaacttcgaacactccacttctccacattta |
36748975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 580871 - 580803
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
580871 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
580803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 199
Target Start/End: Complemental strand, 10463270 - 10463193
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacacccc |
199 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| | ||||| ||||||||||| |||| ||||||||||||| ||||||| |
|
|
| T |
10463270 |
tccccgtgagcttagctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccgaacacccc |
10463193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 11133082 - 11133151
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| | ||||| ||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
11133082 |
tagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccactt |
11133151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 14835285 - 14835369
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||||||| || |||||||| | ||| |||||||||||||||||||| |
|
|
| T |
14835285 |
tgagtttagctcagttgatagtgatattgtatattatatgcaggggcttgggttcgaa-cttggagaccccacttctccacattta |
14835369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 29034982 - 29035051
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| |||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
29034982 |
tagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
29035051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 30474283 - 30474215
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
30474283 |
tagctcagttggtagg-acaatgcattattatatgcaggggccgaggttcgaaccccagacaccccactt |
30474215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 34125759 - 34125863
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||| | ||||||| |||||| |||| ||||||||||||||||| | |||||||| | |||||||||| |
|
|
| T |
34125759 |
ctcagttggtagggacattgcatgatttatgcagggacggaggttcaaacccctgaca-cccacttctccacatttaaaatgtgtgagccctagccacta |
34125857 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
| |||| |
|
|
| T |
34125858 |
gactac |
34125863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 207
Target Start/End: Complemental strand, 35972616 - 35972547
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
||||||||||||| ||||| |||||| |||||||| || | |||||||||||||||||| ||||||||| |
|
|
| T |
35972616 |
ctcagttggtaggaatattacatattttatgcaggggctggggttcgaaccccggacacttcacttctcc |
35972547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 36143259 - 36143175
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | ||||| || ||||||| ||| |||||| |||||| |||||||| |
|
|
| T |
36143259 |
tgagtttagctcagttggtcgggatattgcatattatacgtaggagtcggagttcgaa-cccaaacacccaacttcttcacattta |
36143175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 43936704 - 43936813
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||| |||| ||||||||||| | | |||||||| |||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
43936704 |
gtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcagggttcgaagttcggatactccacttctccacaattaaattgtgtgagct |
43936803 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
||| |||||| |
|
|
| T |
43936804 |
ctaaccacta |
43936813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 11946114 - 11946026
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||||||||||| |||||| |||||| ||||||||||||||| | |||||| ||| |||||| |||||||||||||| |
|
|
| T |
11946114 |
atccccgtgagtttagctcaattggtaacgatattacatattatatgcaggggttaaggttcaaacttcggacatcccacttctccaca |
11946026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 241
Target Start/End: Original strand, 18073752 - 18073860
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||| ||||| ||| ||||||||| |||| ||||||| ||||||||| ||||||||||||| ||| | ||||||| ||||| | |
|
|
| T |
18073752 |
ttagctcagttggtagagatatcacattttatatgcaaaggccggagttcgaatcccggacactccacttctccacaattaaattgtgtgagttctagtc |
18073851 |
T |
 |
| Q |
233 |
actaggcta |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
18073852 |
actaggcta |
18073860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 202
Target Start/End: Original strand, 24202144 - 24202224
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
|||| ||||| |||||||| |||||| |||||| ||||| | |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
24202144 |
tccccgtgagcttagctcacttggtaagggataatgcattatgtatgcaggggccggggttcgaaccccggacaccccact |
24202224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 30871365 - 30871273
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| ||| ||||||| | | |||||||| ||||||||| ||||||||||||| ||| | ||||||||||||| ||| |||||||| |
|
|
| T |
30871365 |
gatattgcattttacatgcaggggtcagggttcgaatcccggacactccacttctccacaattaaattgtgtgaactctaaccattaggctac |
30871273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 14215877 - 14216000
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| |||| ||| || ||||||||| |||| |||||||||||||| | |||||||| || ||||| ||||||||||| ||||| || |
|
|
| T |
14215877 |
ttatccccgtgagcttagatcaaatgatagggatatcgcatgttatatgcaggagctggggttcgaattccagacacttcacttctccacaatttaattg |
14215976 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||| | |||||||| |
|
|
| T |
14215977 |
tgtgagctctagcaattaggctac |
14216000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 242
Target Start/End: Original strand, 14518315 - 14518402
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| || |||||||| |||| |||||||||| || |||| ||||||||||| |||| | |||||||| ||| |||||||||||||| |
|
|
| T |
14518315 |
tgcattttgtatgcaggggccggggttcgaacctcgaacactccacttctccatatttaaaatgtgtgagctccagccactaggctac |
14518402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 242
Target Start/End: Complemental strand, 15069846 - 15069751
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| || ||||||||||| | || |||||||||||||||||| |||||||| || ||||| ||||||| ||||||| | |||||||| |
|
|
| T |
15069846 |
agggatattgtattttatatgcaggggtcggggttcgaaccccggacactccacttcttcataatttaattgtgtgagctctagcgaataggctac |
15069751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 17154681 - 17154724
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
17154681 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
17154724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 22333829 - 22333892
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| ||||||| ||| ||| |||||||||| |
|
|
| T |
22333829 |
ggttcgaagcctggacaccccacttctccacatttaattgtgtgagctccagcaactaggctac |
22333892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 31411924 - 31411805
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| |||||||| |||||| | | |||| ||| | |||||||| || || ||||||| |||| ||||||||||| | |||||||| |||||| |
|
|
| T |
31411924 |
tccccgtgagcttagctcaattggtatgaacattgtataatttatgcaggggctgaagttcgaatcccgaacaccccactttttcacatttaattgtgtg |
31411825 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| || ||||||||| ||||| |
|
|
| T |
31411824 |
agctatagccactaagctac |
31411805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 36101690 - 36101737
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
36101690 |
tgcatattatatgcaggggctggggttcgaaccccggacaccccactt |
36101737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 41187263 - 41187377
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||| ||||| |||||||||||| |||| | |||| ||| ||| ||||||||||||||||| ||||| ||||||| || |
|
|
| T |
41187263 |
gtgagcttaactcagttggtagaaatattacatattatatgctggagttggggtttgaa-tccgaacaccccacttctccacaatttaattgtgtgagct |
41187361 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
41187362 |
ctagccactagactac |
41187377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 43870985 - 43871028
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
43870985 |
tattatatgcaggagccggggttcgaatcccggacaccccactt |
43871028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 7907617 - 7907495
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||| | | |||||||||||||||||||||||||| || || | ||||||||| | |||||||||||||| || ||||| ||| |
|
|
| T |
7907617 |
tatccccgtgagcttagtttaattggtagggatattgcatattatatggtggggctggagttcgaaccacaaacaccccacttctctacaatttaattgt |
7907518 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||| |||||||||||| |
|
|
| T |
7907517 |
gtgagttctaaccactaggctac |
7907495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 242
Target Start/End: Complemental strand, 8234855 - 8234775
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||||||| | ||| ||||| | ||||| ||||||||||||||||| |
|
|
| T |
8234855 |
tattatatgtaggggccggggttcgaaccccggacaccccacttattcac-cttataag-gtgaattctagccactaggctac |
8234775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 20641857 - 20641939
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||| | ||| ||||||||| |||| ||||||| ||| | |||||||||||||||||||| |||||||| |||| |
|
|
| T |
20641857 |
gtgagcttagcttaattgatagggatatcgcattttatatgtaggggttgaggttcgaaccccggacactccacttcttcaca |
20641939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 141 - 203
Target Start/End: Original strand, 22589915 - 22589976
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | || ||| |||||||| ||||||||||| |
|
|
| T |
22589915 |
agttggtagggatattgcatattatatgcagg-gtcggtgtttgaaccccgaacaccccactt |
22589976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 36113021 - 36112936
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgca-tattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||| || ||| ||||||||| ||||||||||| |||| ||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
36113021 |
tgagtttagctcaattagtaaagatattgcaatattatatgcatgagctgaggttcgaaccctagaca-ctcacttctccacattta |
36112936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 138 - 203
Target Start/End: Original strand, 41699112 - 41699177
Alignment:
| Q |
138 |
ctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| | || ||||||||||||| ||||||||||| |
|
|
| T |
41699112 |
ctcagttggtagg-atattgcattattatatgcaggggtcggggttcgaaccccgaacaccccactt |
41699177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 122 - 188
Target Start/End: Original strand, 42039205 - 42039271
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
188 |
Q |
| |
|
|||| ||||||||||||||||||| || ||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
42039205 |
atccatgtgagtttagctcagttgatatggatagtgcatattatatgcagaggttgaggttcgaacc |
42039271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 44658333 - 44658395
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||||||||||||||| || || |||| |||||| |
|
|
| T |
44658333 |
gtgagcttagctcagttagtaggaatattgcatattatatgcaggggctgatgttcaaacccc |
44658395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 203
Target Start/End: Original strand, 1962848 - 1962901
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| |||||||| |||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
1962848 |
ggataatgcatattgtatgcaggggtcgaggttcgaactccggacaccccactt |
1962901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 2304284 - 2304365
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||| | || || |||||||| ||| | || ||||||||||||||||||||||||| |
|
|
| T |
2304284 |
tccccgtgagcttagctcagttggcagggacaatgtattattatatgtaggggtcggggttcgaaccccggacaccccactt |
2304365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 3037683 - 3037642
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
3037683 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
3037642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 167
Target Start/End: Original strand, 5062294 - 5062339
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
5062294 |
atccccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 214
Target Start/End: Complemental strand, 10679449 - 10679357
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||||||| |||||||||| | || || | |||||||||| | ||| | | ||||||||||||||| |
|
|
| T |
10679449 |
tatccctctgagcttagctcagttggta-ggatattacatattatattcgggggctggggttcgaacctcagacgctcaacttctccacattta |
10679357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 201
Target Start/End: Original strand, 12747741 - 12747814
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||| ||| |||||||||||| |||||||||||||||| ||| || | |||||||||||||||||| |||| |
|
|
| T |
12747741 |
gtgagcttaactcagttggtagaaatattgcatattatatacagaagttggggttcgaaccccggacactccac |
12747814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 19253915 - 19254024
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtgaactctagcc |
232 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||| || | | ||||||||| ||||| | ||||||||||||| ||| || |||||| |||||||| |
|
|
| T |
19253915 |
ttagcttagttggtatgaatattgcatattatatttagaggttggggttcgaacaccggatatcccacttctccacgattaaattgtgtgagctctagcc |
19254014 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
19254015 |
actaggctac |
19254024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 20435775 - 20435856
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| |||||||| |||||| ||||||||||||||| |||||| | ||| |||||||||| |||||| ||||||| |
|
|
| T |
20435775 |
tccccgtgagcttagctcacttggtaagggatattgcatattttatgcaaggcccggggttcgaacctcggacatcccactt |
20435856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 237
Target Start/End: Original strand, 24374214 - 24374310
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||| | || |||||||| || | ||||||||||| |||| |||| | ||||||| ||||||||||||| |
|
|
| T |
24374214 |
agttggtaaggatattgcatattatatgtagg-gtcgtggttcgaatcctgaacaccccacttatccatatttaaaatgtgtgtcctctagccactag |
24374310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 221
Target Start/End: Original strand, 26336683 - 26336776
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||| ||| | || |||||||||| || |||| |||||||| |||||| | |||||| |
|
|
| T |
26336683 |
gtgagtttagcccagttgacaaagatattgcatattatatgaaggggtcggggttcgaacctcgaacactccacttcttcacattaaaatgtgt |
26336776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 32527166 - 32527097
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| |||||||||||| |||| ||||||| |
|
|
| T |
32527166 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaacccactt |
32527097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 32858004 - 32857899
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||| | | | ||||||||| | |||||| |||||||||||||| |||||||||| ||| | |||||| |
|
|
| T |
32858004 |
ctcagttggtagggatattacatattacatgcatgtgtctgagttcgaaccacaaacacccaacttctccacatttaatatgtgtgagctcaaaccacta |
32857905 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
| |||| |
|
|
| T |
32857904 |
gactac |
32857899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 34034357 - 34034425
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | | ||| ||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
34034357 |
tagctcagttggcagggacaatacattattatatgcagga-ccggggttcgaaccccggacaccccactt |
34034425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 203
Target Start/End: Original strand, 44187714 - 44187779
Alignment:
| Q |
139 |
tcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| ||||||| ||||| |||||||||||| | || |||||||||||| |||||||||||| |
|
|
| T |
44187714 |
tcagttggcagggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccactt |
44187779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 1027690 - 1027586
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||| |||| ||||||||||| | |||||| | | | |||||||||| | ||||| | |||||| |||||||| ||||||| |||| |||||||| |
|
|
| T |
1027690 |
ctcagtttgtagagatattgcataatttatgcaagggtcagggttcgaacctcagacactctacttctacacatttaattgtgtgagctctggccactag |
1027591 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
1027590 |
gctac |
1027586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 203
Target Start/End: Complemental strand, 8727019 - 8726967
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| ||||| || |||||||||| ||||||| |||||| |
|
|
| T |
8727019 |
gatattgcatattatatgtaggagtcggggttcgaacctcggacactccactt |
8726967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 171
Target Start/End: Complemental strand, 27464199 - 27464155
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
27464199 |
tgtgaatttagctcagttggtaggaatattgcatgttatatgcag |
27464155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 214
Target Start/End: Original strand, 28819494 - 28819562
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggaca-ccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||| | |||||||| | |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
28819494 |
tagggatattgcataatttatgcaggggttgaggttcgaaccatggacacccccacttctccacattta |
28819562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 210
Target Start/End: Complemental strand, 36089182 - 36089110
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||| | | |||| ||||||| || || ||||||||||||| |
|
|
| T |
36089182 |
ctcagttggcagggatattgcatattatatacaggggttggggtttgaaccccagatactccacttctccaca |
36089110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 36665430 - 36665505
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| |||||||||| ||||| | | ||||| |||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
36665430 |
gtgagtatagctcagtttgtagg-acaatgcattattatatgcaggggccggggttcgaacctcggacaccccactt |
36665505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 172
Target Start/End: Original strand, 39265685 - 39265725
Alignment:
| Q |
132 |
gtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
39265685 |
gtttagctcagttggtagcgatactgcatattatatgcagg |
39265725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 5003706 - 5003659
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5003706 |
cctgtgagcttgactcagttggtagggatattgcattttatatgcagg |
5003659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 9796929 - 9796972
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
9796929 |
tattatatgcaggggtcggggttcgaaccccggacaccccactt |
9796972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 198
Target Start/End: Original strand, 11832946 - 11833021
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccc |
198 |
Q |
| |
|
|||| ||||| |||| |||||||| | ||||||| ||||||||||| ||| || | |||||||||| ||||||||| |
|
|
| T |
11832946 |
tccccgtgagcttagttcagttggcaaggatatttcatattatatgtaggggctggggttcgaaccacggacaccc |
11833021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 137 - 203
Target Start/End: Complemental strand, 14307780 - 14307714
Alignment:
| Q |
137 |
gctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| || |||| ||||||||||| | |||||||||||||||| ||||||||||| |
|
|
| T |
14307780 |
gctcagttggtagggacat-gcattgttatatgcaggggtcgaggttcgaaccccgaacaccccactt |
14307714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 34434461 - 34434346
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| || ||||| ||||||||||| |||||||||||||| | | |||||||||||| ||| |||||||||||| ||||| ||| ||| || |
|
|
| T |
34434461 |
gtgagcttaacttagttgatagggatattgtatattatatgcaggggttggggttcgaaccccacacattccacttctccacaatttaattgtatgatct |
34434362 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
34434361 |
atagccactagactac |
34434346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 42998920 - 42998833
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| ||||||||||| ||| | | || ||| |||||||||| |||| |||||||| |||||||||| |||||||| |||||| |
|
|
| T |
42998920 |
tgtgagtctagctcagttgatagaaagaatgtataatatatgcaggggccggagttcgaactccggacacccgacttctccgcattta |
42998833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 43684279 - 43684353
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| ||||| || |||||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
43684279 |
tgagcttagctcatttggtaagggataatgcat-ttgtatgcaggggctgaggttcgaaccccgaacaccccactt |
43684353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Complemental strand, 3197140 - 3197098
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
3197140 |
gtgagtttagctcagttggtagggacaatgcataatatatgca |
3197098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 141 - 211
Target Start/End: Complemental strand, 4858755 - 4858686
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacat |
211 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| || | |||||||| | ||| |||||||||||||||||| |
|
|
| T |
4858755 |
agttggtagggacattgcataatttatgcaggggctggggttcgaatctcgg-caccccacttctccacat |
4858686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 214
Target Start/End: Complemental strand, 6859220 - 6859186
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6859220 |
gttcgaaccccggacacccaacttctccacattta |
6859186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 7717672 - 7717586
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||| |||||||||||||| | || || ||||||||||| | || ||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
7717672 |
tgagcttagttcagttggtagggacaaatgtattttatatgcaggggtcggggttcgaacttcggacactccacttctccacattta |
7717586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #219
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 242
Target Start/End: Original strand, 11201152 - 11201226
Alignment:
| Q |
165 |
tatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| | |||||||| ||||||| ||||||| |||||| |||||||||| |
|
|
| T |
11201152 |
tatgcaggagccgag-ttcgaaccccgaacatctcacttctctacatttaattgtgtgacctctag--actaggctac |
11201226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #220
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 242
Target Start/End: Original strand, 17524913 - 17524955
Alignment:
| Q |
200 |
acttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
17524913 |
acttctccacatttaaatgtgtgagctccagccactaggctac |
17524955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #221
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 18255655 - 18255705
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
||||||||||| |||||| |||||||| |||||||||||||| | |||||| |
|
|
| T |
18255655 |
ttatatgcaggggccgagtttcgaacctcggacaccccacttattcacatt |
18255705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #222
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 21875033 - 21874991
Alignment:
| Q |
161 |
attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
21875033 |
attatatgcaggggcagaggttcgatccccggacaccccactt |
21874991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #223
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 200
Target Start/End: Complemental strand, 22297540 - 22297475
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
22297540 |
tagctcagttggtagg-acaatgcattattatatgcaggggcaggggttcgaaccccggacacccca |
22297475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #224
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 197
Target Start/End: Original strand, 24393240 - 24393314
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||| ||||| |||||||||||| || ||| | |||||| |||||||| | | ||||||||||||||||||||| |
|
|
| T |
24393240 |
tccccgtgagcttagctcagttgttaaggacaatgcataatatatgcaaggtctgaggttcgaaccccggacacc |
24393314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #225
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 197
Target Start/End: Original strand, 27152352 - 27152422
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||||| ||| ||||||||||||||||| |||||| |||||||| | | | ||||||||||| ||||||| |
|
|
| T |
27152352 |
tgtgagcttaactcagttggtagggataatgcataatatatgcaaggtctggggttcgaacccaggacacc |
27152422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #226
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 210
Target Start/End: Complemental strand, 34149723 - 34149665
Alignment:
| Q |
152 |
atattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
34149723 |
atatcgcatattatatgcagtgatcggggttcgaaccccggacaccctacttctccaca |
34149665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #227
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 233
Target Start/End: Original strand, 42756160 - 42756274
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatg |
218 |
Q |
| |
|
|||||||| ||||||||| ||||||| || | ||||| |||||||||| || | || ||||||||| || |||||||||||||| |||||| | | |
|
|
| T |
42756160 |
tttatccccgtgagtttaaatcagttgataagaatattatatattatatgtagtggtcggggttcgaactccatacaccccacttctctacattttaacg |
42756259 |
T |
 |
| Q |
219 |
tgtgaactctagcca |
233 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
42756260 |
tgtgagctctagcca |
42756274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #228
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 242
Target Start/End: Complemental strand, 43057934 - 43057872
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| | ||| |||||||||| || |||||||| |
|
|
| T |
43057934 |
ttcgaaccccggacaccctacttctccacaattaaattgtatgaactctagtcattaggctac |
43057872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #229
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 45119774 - 45119688
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||| ||||||||||| | || || ||||||||||||||| | || ||||||||| ||||||| ||| ||||||| ||||| |
|
|
| T |
45119774 |
gtgaatttaactcagttggtatgaattttacatattatatgcaggggtcggagttcgaacctcggacactccatttctccatattta |
45119688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #230
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 279859 - 279818
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| ||||||| |
|
|
| T |
279859 |
ttatatgcaggagccggggtttgaaccccggacatcccactt |
279818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #231
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 2950410 - 2950349
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||||||||||||||||||||| | | |||||||| | ||||||| ||| ||||||| |
|
|
| T |
2950410 |
tagggatattgcatattatatgcaggggttggggttcgaatctcggacactccatttctcca |
2950349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #232
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 207
Target Start/End: Complemental strand, 11288294 - 11288222
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||| ||| | |||||||| || | ||||||||||||||||| |
|
|
| T |
11288294 |
ttagctcagttgatagtgatattgcatattatatagaggggtcgaggttc-aaactaggacaccccacttctcc |
11288222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #233
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 188
Target Start/End: Original strand, 12124540 - 12124605
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
188 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| | |||||| |||||||| | ||| |||||||||| |
|
|
| T |
12124540 |
tccccgtgagtttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgaacc |
12124605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #234
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 168
Target Start/End: Complemental strand, 18559277 - 18559240
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18559277 |
agtttaactcagttgatagggatattgcatattatatg |
18559240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #235
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 20122563 - 20122495
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||| ||| |||| |||||||||||||||||| |||||| |
|
|
| T |
20122563 |
tagctcagttggtagg-acaatgcattattatatgtaggggccggggttcgaaccccggacacgccactt |
20122495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #236
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 20375587 - 20375668
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| |||||||| |||||| |||||||||| |||| |||||||| ||| |||||||||| | ||||| |||||| |
|
|
| T |
20375587 |
tccccgtgagcttagctcacttggtaagggatattgcctattttatgcagggtccggggttcgaacctcagacacgccactt |
20375668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #237
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 214
Target Start/End: Complemental strand, 25516081 - 25516001
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||||| || ||||| |||||||||| ||| ||||| | || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
25516081 |
tttagttcagtcggcagggacattgcatattttatacaggatcgcag-ttcgaacttcggacaccccacttctccacattta |
25516001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #238
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 34463733 - 34463645
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| ||| |||| |||| ||| | |||||||| |||||||| | || ||||||||||| ||| ||| ||||||||| |||||||| |
|
|
| T |
34463733 |
cctgtgaggttatctcaattgg-aggaacattgcatactatatgcatgggctgaggttcgaactccgaacatcccacttcttcacattta |
34463645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #239
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 36520868 - 36520800
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||| ||| | || ||||||||||||||||||||||||| |
|
|
| T |
36520868 |
tagctcagttggtagg-acaatgcattattatatgtaggggtcggggttcgaaccccggacaccccactt |
36520800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #240
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 154 - 242
Target Start/End: Original strand, 39635329 - 39635418
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| |||||| || | || ||||||||| || ||||| |||||||||||||||| | |||||||| ||| ||||||||| |||| |
|
|
| T |
39635329 |
attgcataatatatgttggggtcggggttcgaactccagacactccacttctccacatttaaaatgtgtgatctccagccactagactac |
39635418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #241
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 168
Target Start/End: Original strand, 41286145 - 41286174
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41286145 |
tcagttggtagggatattgcatattatatg |
41286174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #242
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 210
Target Start/End: Complemental strand, 42329456 - 42329364
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggt----agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| ||| |||| |||||||||| ||||| ||||||| ||| ||||||||||||| |
|
|
| T |
42329456 |
ttatccctgtgagcttagctcagttggtggggagggatattacattttat-cgcaggagccg-ggttcaaaccccgaacattccacttctccaca |
42329364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #243
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 203
Target Start/End: Complemental strand, 44487867 - 44487787
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||| ||||||||||| |||||| || |||| |||||||||| | |||| |||||||||||||||| ||||||| |
|
|
| T |
44487867 |
tccccgtgagtatagctcagttgatagggacat-gcattattatatgcaagggccggagttcgaaccccggacatcccactt |
44487787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #244
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 23403314 - 23403381
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
23403314 |
tagctcagttggtagggacatcacat-ttatatgcaggggcccgggttcgaaccccggattccccactt |
23403381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #245
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 34903518 - 34903586
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||| |||| |||||||||| ||| | |||||| |||||||| | | ||||||||||||||||||||| |
|
|
| T |
34903518 |
tgagcttagttcagttggtaaggacagtgcataatatatgcaaggtctgaggttcgaaccccggacacc |
34903586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #246
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 214
Target Start/End: Complemental strand, 37512433 - 37512357
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| |||| |||||||||| | |||| || |||| |||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
37512433 |
ctcagtttgtagaaatattgcataatttatgtagaggccggggttcgaacctcggacaccccacttcttcacgttta |
37512357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #247
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 214
Target Start/End: Original strand, 44920032 - 44920103
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||| |||||||| | |||||||| | ||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
44920032 |
gttggtagggacattgcataatttatgcagg-gttgaggttcgaacatcggacaccccacttctacatattta |
44920103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 331)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 44652056 - 44651935
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44652056 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggataccccacttctccacatttatatgtg |
44651957 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44651956 |
tgaactctagccactaggctac |
44651935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 53432812 - 53432689
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | || |
|
|
| T |
53432812 |
ttatccctgtgagtttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattg |
53432713 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
53432712 |
tgtgagctctagccactaggctac |
53432689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 18194334 - 18194456
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
18194334 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
18194433 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
18194434 |
gtgagctctagccactaggctac |
18194456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 39719929 - 39720053
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | | |
|
|
| T |
39719929 |
tttattcccgtgagtttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaatt |
39720028 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
39720029 |
gtgtgagctctagccactaggctac |
39720053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 40933907 - 40933783
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | | |
|
|
| T |
40933907 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaatt |
40933808 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
40933807 |
gtgtgagctctagccactaggctac |
40933783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 37800686 - 37800563
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
37800686 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattg |
37800587 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
37800586 |
tgtgagctctagccactaggctac |
37800563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 50496889 - 50496766
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
50496889 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattg |
50496790 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
50496789 |
tgtgagctctagccactaggctac |
50496766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 4139003 - 4139118
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
4139003 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
4139102 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4139103 |
ctagccactaggctac |
4139118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 45701339 - 45701462
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| ||| | || |
|
|
| T |
45701339 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccacaattaaattg |
45701438 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
45701439 |
tgtgagctctagccactaggctac |
45701462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 48515457 - 48515338
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||| |||| | |||||||| | |||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
48515457 |
tccctgtgagcttaactcagttggtagggatattccataatttatgcaggggtcgaggttcgaaccccggacaccacacttctccacatttaaatgtgtg |
48515358 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48515357 |
aactctagccactaggctac |
48515338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 10176976 - 10176855
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
10176877 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| ||||| |
|
|
| T |
10176876 |
tgagctctagccactatgctac |
10176855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 31327574 - 31327453
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| ||| | |||| |
|
|
| T |
31327574 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggaaactccacttctccacaattaaattgtg |
31327475 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
31327474 |
tgagctctagccactaggctac |
31327453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 40548300 - 40548421
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||| ||| | |||| |
|
|
| T |
40548300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtg |
40548399 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
40548400 |
tgagctctagccactaggctac |
40548421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 41936468 - 41936359
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
41936468 |
ttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagcc |
41936369 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
41936368 |
actaggctac |
41936359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 8964852 - 8964728
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||| |||| ||||||||||||| ||| | | |
|
|
| T |
8964852 |
tttatccccgtgagtttagctcagttggtagggatattgcatatcatatgcaggagccggggttcgaactccgaacactccacttctccacaattaaatt |
8964753 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
8964752 |
gtgtgagctctagccactaggctac |
8964728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 15975146 - 15975270
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||| |||| ||| | | |
|
|
| T |
15975146 |
tttatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacctcggacactccacttcttcacaattaaatt |
15975245 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||| |||||||||||| |
|
|
| T |
15975246 |
gtgtgagctctaaccactaggctac |
15975270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 6920030 - 6919915
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
6920030 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagct |
6919931 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6919930 |
ctagccactaggctac |
6919915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 31327791 - 31327676
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
31327791 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
31327692 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
31327691 |
tgagctctagccacta |
31327676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 48251567 - 48251690
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||| |||||| |||||| ||||||||||||| ||| | || |
|
|
| T |
48251567 |
ttatccctgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttagaaccctggacactccacttctccacaattaaattg |
48251666 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
48251667 |
tgtgagctctagccactaggctac |
48251690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 50234127 - 50234242
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
50234127 |
gtgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
50234226 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50234227 |
ctagccactaggctac |
50234242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 7269952 - 7270073
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||| ||||||||||||| ||| | |||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttctccacaattaaattgtg |
7270051 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
7270052 |
tgagctctagccactaggctac |
7270073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 7920317 - 7920438
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| | ||||||||||| ||| | |||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccggacactcaacttctccacaattaaattgtg |
7920416 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
7920417 |
tgagctctagccactaggctac |
7920438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 34102684 - 34102567
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaactgtg |
34102585 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
34102584 |
tgagctctagccactagg |
34102567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 52974126 - 52974005
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
52974126 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
52974027 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||| |||||| |
|
|
| T |
52974026 |
tgagctctagccactgggctac |
52974005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 53163591 - 53163712
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||| || ||| | |||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccacttctccgcaattaaattgtg |
53163690 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
53163691 |
tgagctctagccactaggctac |
53163712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 121 - 236
Target Start/End: Complemental strand, 32256628 - 32256512
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | ||| |
|
|
| T |
32256628 |
tatccccgtgagcttagctcagttggtagggatattgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgt |
32256529 |
T |
 |
| Q |
220 |
gtgaactctagccacta |
236 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
32256528 |
gtgagctctagccacta |
32256512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 53577957 - 53578073
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| | |
|
|
| T |
53577957 |
tgtgagcttagctcagttggtagggatgttgcatattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagc |
53578056 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53578057 |
tctagccactaggctac |
53578073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 2522921 - 2523044
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||| |||| | |||| ||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
2522921 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaagagctggggtttgaaccccggacactccacttctccacaattaaattg |
2523020 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
2523021 |
tgtgagctctagccactaggctac |
2523044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 9176653 - 9176538
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
9176653 |
gtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
9176554 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
9176553 |
ctagccagtaggctac |
9176538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 10482928 - 10482805
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||| ||||||||||||| ||| | || |
|
|
| T |
10482928 |
ttatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttctccacaattaaattg |
10482829 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
10482828 |
tgtgagctctagccactaggctac |
10482805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 234
Target Start/End: Complemental strand, 17602743 - 17602636
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
17602743 |
gtgagcttagctcagttggtagggatattgcatattatatgtaggggccgaggttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
17602644 |
T |
 |
| Q |
227 |
ctagccac |
234 |
Q |
| |
|
|||||||| |
|
|
| T |
17602643 |
ctagccac |
17602636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 5636873 - 5636751
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| | ||||||||||| ||| | ||| |
|
|
| T |
5636873 |
tatccttgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactcgacttctccacaattaaattgt |
5636774 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||| ||||||||||| |
|
|
| T |
5636773 |
gtgagctctagtcactaggctac |
5636751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 241
Target Start/End: Original strand, 24303388 - 24303506
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24303388 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtg |
24303487 |
T |
 |
| Q |
223 |
aactctagccactaggcta |
241 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
24303488 |
agctctagccactaggcta |
24303506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 28689746 - 28689624
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| ||||| ||| |
|
|
| T |
28689746 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaatttaattgt |
28689647 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||| ||||||||||||| |
|
|
| T |
28689646 |
gtgagctctggccactaggctac |
28689624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 54769897 - 54769783
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
54769897 |
gtgagcttagcttagttggtagggatattgcatattatatgcaggtgccggagttcgaaccacggacaccccacttctccacatttaattgtgtgagctc |
54769798 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
54769797 |
tagcaactaggctac |
54769783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 22502004 - 22501883
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtg |
22501905 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
22501904 |
tgagctctagccactaggctac |
22501883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 238
Target Start/End: Original strand, 32144581 - 32144698
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||| | |||| |
|
|
| T |
32144581 |
atccccgtgagcttagcttagttggtaggggtattgcatattatatgcaggagccggggttcgaaccccggacaccccatttctccacaattaaattgtg |
32144680 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
32144681 |
tgagctctagccactagg |
32144698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 33706800 - 33706679
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||| ||||||||||||| |||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
33706800 |
atccccgtgagcttagctcaattggtagggatattacatattatatgcaagagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
33706701 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
33706700 |
tgagctctagccactaggctac |
33706679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 121 - 237
Target Start/End: Complemental strand, 34898841 - 34898724
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||| ||| | ||| |
|
|
| T |
34898841 |
tatccccgtgagcttagttcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacaccccacttctccacaattaaattgt |
34898742 |
T |
 |
| Q |
220 |
gtgaactctagccactag |
237 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
34898741 |
gtgagctctagccactag |
34898724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 37488533 - 37488412
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| |||| ||||||||||| |||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
37488533 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtg |
37488434 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
37488433 |
tgagctctagccactaggctac |
37488412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 49443489 - 49443376
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| | |||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
49443489 |
tgagtttagctcaattggcagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccacatttaaatgtgtgagctct |
49443390 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49443389 |
agccactaggctac |
49443376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 52410314 - 52410193
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||| ||||||||||||| ||| | |||| |
|
|
| T |
52410314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggattcgaaccccagacactccacttctccacaattaaattgtg |
52410215 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
52410214 |
tgagctctagccactagactac |
52410193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 30555303 - 30555179
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||| ||||| |||| | || ||||||||||||||| ||||||||||||| ||| | | |
|
|
| T |
30555303 |
tttatccccgtgagcttagctcagttggtagggatattgcatattaaatgcaagagcaggggatcgaaccccggacactccacttctccacaattaaatt |
30555204 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
30555203 |
gtgtgagctctagccactaggctac |
30555179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 122 - 241
Target Start/End: Complemental strand, 31529031 - 31528911
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgta |
31528932 |
T |
 |
| Q |
221 |
tgaactctagccactaggcta |
241 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
31528931 |
tgagctctagccactaggcta |
31528911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 49447135 - 49447223
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
49447135 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccaca |
49447223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 30779634 - 30779519
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||||||||||||||| ||||| ||||||| | |
|
|
| T |
30779634 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacaccccacttctccacaatttaattgtgtgagtt |
30779535 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30779534 |
ctagccactaggctac |
30779519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 47098735 - 47098850
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
47098735 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
47098834 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
47098835 |
ctagccactaagctac |
47098850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 17218492 - 17218606
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| | |||| ||||| |||||||||||| |||||||||||| ||||| ||||||| ||| |
|
|
| T |
17218492 |
tgagcttagctcagttggtagggatattgcatattatatgcaagggccggggttcaaaccccggacactccacttctccacaatttaattgtgtgagctc |
17218591 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
17218592 |
tagccactaggctac |
17218606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 25939004 - 25938882
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgt |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||| |||| ||||||||||| ||||| ||| |
|
|
| T |
25939004 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccacacactccacttctccataatttaactgt |
25938905 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
25938904 |
gtgagctctagccactaggctac |
25938882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 48739818 - 48739696
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||| ||||||||||| || | |||||||||||| ||||||||||||||||||| ||| | ||| |
|
|
| T |
48739818 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaactgt |
48739719 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||| |||| |
|
|
| T |
48739718 |
gtgagctctagccactagactac |
48739696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 22472387 - 22472267
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
22472387 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgcaagagccggggttcgaaccccggacaccccacttctccacaattaaattgtg |
22472288 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| |||||||| |
|
|
| T |
22472287 |
tgagctctagcca-taggctac |
22472267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 33225421 - 33225300
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| |||| |||||||||||||||| |||||||||||| ||||| ||||||||||||| ||| | |||| |
|
|
| T |
33225421 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtg |
33225322 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| ||||| |
|
|
| T |
33225321 |
tgagctctagccactaagctac |
33225300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 3894547 - 3894662
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||| |||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
3894547 |
gtgagcttagttcagttggtatggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaattgtgtgagct |
3894646 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
3894647 |
ctagccactagactac |
3894662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 52309177 - 52309065
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||| |||||||||||| || |||||||||||| ||||||||||||||||||||||| || ||||| || |
|
|
| T |
52309177 |
gtgagcttaactcagttggtagggatattgcatactatatgcaggagtcggggttcgaaccccagacaccccacttctccacattta-at-tgtgagttc |
52309080 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52309079 |
tagccactaggctac |
52309065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 3748675 - 3748554
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| |||||||||||||| | | ||||||||||||||||| | ||||||||||| ||||| |||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcaggggttggggttcgaaccccggacatctcacttctccacaatttaattgtg |
3748576 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
3748575 |
tgagctctagccactaggctac |
3748554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 11820001 - 11820122
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| ||||||| ||||| || ||||||||||||||| || ||||||||||||| ||| | |||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgtaggagtcggggttcgaaccccggaaactccacttctccacaattaaattgtg |
11820100 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
11820101 |
tgagctctagccactagactac |
11820122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 17608392 - 17608271
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||| || |||||||||||||||||||||||||||||||| |||| ||||||||||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
17608392 |
atccccgtgagcttaacttagttggtagggatattgcatattatatgcaggggccggggttcgaaccctggacactccacttctccacaatttaattgtg |
17608293 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
17608292 |
tgagttctagccactaggctac |
17608271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 19550502 - 19550623
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||| ||| | ||| |
|
|
| T |
19550502 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagcttgtgttcgaaccccgtacactccacttctccacaattaaattgt |
19550601 |
T |
 |
| Q |
220 |
gtgaactctagccactaggcta |
241 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
19550602 |
gtgagttctagccactaggcta |
19550623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 133 - 242
Target Start/End: Original strand, 38949682 - 38949791
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||||||| |||| ||||||||||||| |||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
38949682 |
tttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccgaacaccccacttctccacatttaatagtgtgagctccagcc |
38949781 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
38949782 |
actaggctac |
38949791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 45551882 - 45551761
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| |||| ||||||| ||| |||| | |||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
45551882 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgtaggggccgggattcgaaccccggacactccacttctccacaattaaattgtg |
45551783 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
45551782 |
tgagctctagccactaggctac |
45551761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 4860164 - 4860279
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| ||||||||||| || |||||||||||||| ||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
4860164 |
gtgagcttagctcagttggtacggatattgcattttatatgcaggggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagct |
4860263 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| ||||||| |||| |
|
|
| T |
4860264 |
ctaaccactagactac |
4860279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 241
Target Start/End: Complemental strand, 40910243 - 40910133
Alignment:
| Q |
134 |
ttagctcagttggtaggg--atattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctag |
230 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| || ||||| |||||||| ||||| ||||||||||||| ||||| ||||||| |||||| |
|
|
| T |
40910243 |
ttagctcagttggtagggggatattgcatattatatgcaggggctgaggtccgaaccccagacactccacttctccacaattatattgtgtgagctctag |
40910144 |
T |
 |
| Q |
231 |
ccactaggcta |
241 |
Q |
| |
|
||||||||||| |
|
|
| T |
40910143 |
ccactaggcta |
40910133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 50675809 - 50675694
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||| | | ||||||||| | |||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
50675809 |
gtgagtttatctcagttggtagggatattgcatattatatacaggggttgtggttcgaactctggacaccccacttctccacaattaaattgtgtgagct |
50675710 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50675709 |
ctagccactaggctac |
50675694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 53347365 - 53347242
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||||||| ||||| |||||||||||| ||||| || |
|
|
| T |
53347365 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagggactggggttcgaaccccagacactccacttctccacaatttaattg |
53347266 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||| ||||||| ||||| |
|
|
| T |
53347265 |
tgtgagctctggccactaagctac |
53347242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 882385 - 882507
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||| | |||| |||||| ||||| ||||| ||| |
|
|
| T |
882385 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccctgaacactccacttttccacaatttaattgt |
882484 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||| |||||||||||| |
|
|
| T |
882485 |
gtgagttctaaccactaggctac |
882507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 6488128 - 6488242
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||| || |||||||||||| ||||| |||||||||||| ||||| ||||||| ||| |
|
|
| T |
6488128 |
tgagcttagctcaattggtagggatattgcatattatatgcaggggctagggttcgaaccccagacactccacttctccacaatttaattgtgtgagctc |
6488227 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6488228 |
tagccactaggctac |
6488242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 122 - 231
Target Start/End: Complemental strand, 19996525 - 19996415
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagttggggttcgaaccccggacactccacttctccacaattaaattgtg |
19996426 |
T |
 |
| Q |
221 |
tgaactctagc |
231 |
Q |
| |
|
||| ||||||| |
|
|
| T |
19996425 |
tgagctctagc |
19996415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 44764725 - 44764836
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| | |||||||| || | ||||||||||||||||| ||||||||||||||||| ||||||| ||| |
|
|
| T |
44764725 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggggcgg--gttcgaaccccggacactccacttctccacatttaattgtgtgagctc |
44764822 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44764823 |
tagccactaggcta |
44764836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 117 - 242
Target Start/End: Complemental strand, 46796007 - 46795881
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||| | |||| ||| ||||||||| ||| | |
|
|
| T |
46796007 |
aattaatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaaccctgaacactccatttctccacaattaaa |
46795908 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||| |||||||| |
|
|
| T |
46795907 |
ttgtgtgagctctagccattaggctac |
46795881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 138 - 238
Target Start/End: Original strand, 11436517 - 11436618
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| ||| | ||||||| |||| |||||| |
|
|
| T |
11436517 |
ctcagttggtagggatattgcatattatatgcaggggccgtggttcgaaccctggacaccccacttctccacaattaaattgtgtgagttctaaccacta |
11436616 |
T |
 |
| Q |
237 |
gg |
238 |
Q |
| |
|
|| |
|
|
| T |
11436617 |
gg |
11436618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 26942762 - 26942871
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||| | ||||||||||||||| ||| ||| | ||||||| |||||||| |
|
|
| T |
26942762 |
ttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccgcagacaccccacttctctacaattaaattgtgtgagctctagcc |
26942861 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
| |||||||| |
|
|
| T |
26942862 |
attaggctac |
26942871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 27330005 - 27329884
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
27330005 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
27329906 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
27329905 |
tgagctccagccactaggctac |
27329884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 129 - 233
Target Start/End: Original strand, 31586951 - 31587056
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| | || ||||||| ||||||||||||||||||||||| ||| | ||||||| ||| |
|
|
| T |
31586951 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaatcccggacaccccacttctccacaattaaattgtgtgagctc |
31587050 |
T |
 |
| Q |
228 |
tagcca |
233 |
Q |
| |
|
|||||| |
|
|
| T |
31587051 |
tagcca |
31587056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 33607000 - 33606892
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||| | || |||||||||||||||||| |||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
33607000 |
ttagctcaattggtagggatattgcattttatatgcaggggtcg-ggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagcc |
33606902 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
33606901 |
actaggctac |
33606892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 39966147 - 39966026
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||| | ||||| |||||||||||| ||||| |||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggttgaggttcgaacctcagacactccacttctccacaatttaattgtg |
39966048 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| || ||||| |
|
|
| T |
39966047 |
tgagctctagccattatgctac |
39966026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 51879092 - 51879213
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
51879092 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
51879191 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
51879192 |
tgagctccagccactaggctac |
51879213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 28550392 - 28550265
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac------cccacttctccacatttat |
215 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| ||| |
|
|
| T |
28550392 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaagttcgaactccggacaccccaaccccacttctccacaattaa |
28550293 |
T |
 |
| Q |
216 |
a-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
| ||||||| ||||||||||||| |||| |
|
|
| T |
28550292 |
attgtgtgagctctagccactagtctac |
28550265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 4541901 - 4542015
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||| ||||||||||||||||||| |||||||||||||| || | |||||| ||||| ||||| |||||||||||| ||||| |||||||||| |
|
|
| T |
4541901 |
gtgagcttagttcagttggtagggatattgtatattatatgcaggggctggggttcg-accccagacactccacttctccacaatttaattgtgtgaact |
4541999 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4542000 |
ctagccactaggctac |
4542015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 4880172 - 4880287
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| |||||||||| || |||||||||||||| ||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
4880172 |
gtgagcttagctcagttggtacggatattgcattttatatgcagtggctgaggttcgaaccccagacaccccacttctccacaattaaattgtgtgagct |
4880271 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| ||||||| |||| |
|
|
| T |
4880272 |
ctaaccactagactac |
4880287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 19591654 - 19591531
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| |||| |||||||||||| || | ||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||| | ||| | || |
|
|
| T |
19591654 |
ttatccccttgagcttagctcagttgataagtatattgcatattatatgtaggagccggggttcgaaccccggacactccacttctccataattaaattg |
19591555 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
|| || |||||||||||||||||| |
|
|
| T |
19591554 |
tgagagctctagccactaggctac |
19591531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 32828444 - 32828559
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||| |||||| ||| ||| ||||| |||||| |||||| ||| | ||||||| || |
|
|
| T |
32828444 |
gtgagcttagctcggttggtagggatattgcatattatatgcaggagctgaggtttgaatcccagacactccacttttccacaattaaattgtgtgagct |
32828543 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
32828544 |
ctagccattaggctac |
32828559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 2007157 - 2007035
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||| ||| |||||||||||| ||||||||||||||||||||||| || |||| ||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
2007157 |
tatccccgtgaacttaactcagttggtagaaatattgcatattatatgcaggagtcggggtttgaaccccggacactccacttctccacaattaaattgt |
2007058 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| |||||||||||| |
|
|
| T |
2007057 |
gtgagctctatccactaggctac |
2007035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 4227811 - 4227697
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | |||||||| | || ||||||||| |||||||||||||||||||| | ||| ||||||| ||| |
|
|
| T |
4227811 |
gtgagtttagctcagttggtagggacattgcataatttatgcaggggtcggggttcgaactccggacaccccacttctccataattaattgtgtgagctc |
4227712 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||| ||| |||| |
|
|
| T |
4227711 |
tagccattagactac |
4227697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 223
Target Start/End: Original strand, 40192152 - 40192254
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||| | || ||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
40192152 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagaggtcggtgttcgaatcccggacactccacttctccacatttaattgtg |
40192251 |
T |
 |
| Q |
221 |
tga |
223 |
Q |
| |
|
||| |
|
|
| T |
40192252 |
tga |
40192254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 128 - 241
Target Start/End: Complemental strand, 52670220 - 52670106
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| || || |||||||||||||||| |||| |||||||||| ||| || ||||||| || |
|
|
| T |
52670220 |
gtgagcttagttcagttggtagggatattgcatattatatgtagaagtcgaggttcgaaccccgaacacttcacttctccataattaatttgtgtgagct |
52670121 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52670120 |
ctagccactaggcta |
52670106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 4640541 - 4640432
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||| || |||| |||||||| |||| ||| | ||||||| ||||| | |
|
|
| T |
4640541 |
ttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacctcgaacactccacttcttcacaattaaattgtgtgagctctaatc |
4640442 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
4640441 |
actaggctac |
4640432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 13638318 - 13638197
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||| ||||||||||| ||| || | |||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
13638318 |
atccccgtgagcttagttcagttggtagggatattacatattatatgtaggggctggggttcgaaccccagacactccacttctccacaatttaattgtg |
13638219 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || ||||||||||||||| |
|
|
| T |
13638218 |
tgagctatagccactaggctac |
13638197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 19999864 - 19999985
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||||| ||||| | | |||||||| ||||| |||| |
|
|
| T |
19999864 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactctagttctccacaatttaattgtg |
19999963 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| ||||||||||| |
|
|
| T |
19999964 |
tgagttctagtcactaggctac |
19999985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 25884061 - 25883940
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| |||||| |||||||||||| | |||||| |||||||||| | || ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
25884061 |
tccccgtgagcttagcttagttggtagggacaaatgcataatatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
25883962 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
25883961 |
tgagctccagccactaggctac |
25883940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 217
Target Start/End: Complemental strand, 25954861 - 25954772
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat |
217 |
Q |
| |
|
||||| |||||||| |||||| |||||| |||||||||||||||| ||||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
25954861 |
gtgaggttagctcaattggtatggatatcgcatattatatgcaggggccgaggttcgaacctcggacaccccatttctccacaattatat |
25954772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 133 - 210
Target Start/End: Complemental strand, 42108244 - 42108167
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
42108244 |
tttagctcagttggtagggatattgcatattatatgcagaggccgggtttcgaaccccggacgccccacttctccaca |
42108167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 42920720 - 42920599
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| |||| ||||||||||| | | |||||||||||| ||||| ||||||||||||| ||| | |||| |
|
|
| T |
42920720 |
atccctgtgaatttagctcagttggtaggaatatcgcattttatatgcaggggttggggttcgaaccccagacactccacttctccacaattaaattgtg |
42920621 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||| ||||||||||||| |
|
|
| T |
42920620 |
tgagctctggccactaggctac |
42920599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 125 - 233
Target Start/End: Original strand, 52984010 - 52984119
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtga |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||| | | || |||||||||||||||||| ||||||||| ||| ||| | ||||||| |
|
|
| T |
52984010 |
cctgtgagcttagctcagttggtagggatattgcatattgtatgcaagggtcggggttcgaaccccggacactccacttctctacaattaaattgtgtga |
52984109 |
T |
 |
| Q |
224 |
actctagcca |
233 |
Q |
| |
|
||||||||| |
|
|
| T |
52984110 |
gctctagcca |
52984119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 53752773 - 53752652
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||| |||||||||||||||| || | |||||||||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
53752773 |
atccccgtgagcttaactcagttggtagggatatggcatattatatgcaggggcaggagttcgaaccctggacactccacttctccacaatttaattgtg |
53752674 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
53752673 |
tgagttctagccactaggctac |
53752652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 142 - 242
Target Start/End: Complemental strand, 5174063 - 5173963
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||||| || |||||||| | |||||||| || | ||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
5174063 |
gttggtagagacattgcataatttatgcaggggcaggggttcgaaccccgaacaccccacttctccacatttaattgtgtgagctctagccactaggcta |
5173964 |
T |
 |
| Q |
242 |
c |
242 |
Q |
| |
|
| |
|
|
| T |
5173963 |
c |
5173963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 128 - 235
Target Start/End: Complemental strand, 25279126 - 25279018
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||| ||||||||||||||||| |||||||||| ||| |||| | || ||||||||||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
25279126 |
gtgagcttagcttagttggtagggatattgtatattatatgtaggggccgggatttgaaccccggacaccccacttctccacaattaaattgtgtgagct |
25279027 |
T |
 |
| Q |
227 |
ctagccact |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
25279026 |
ctagccact |
25279018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 27454018 - 27453910
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||| ||||||||| |||||||| | ||||||||||| | ||||||||||| ||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
27454018 |
ttagctcaactggtagggacattgcataatttatgcaggagctggggttcgaacccgggacacctttcttctccacatttatatgtgtgagctccagcca |
27453919 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
27453918 |
ctaggctac |
27453910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 118 - 210
Target Start/End: Complemental strand, 29373525 - 29373434
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||| ||||||||||||||||||||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
29373525 |
atttatccc-gtgagcttaactcagttggtaaggatattgcatattatatgcaggggccggggttcgaacctcagacaccccacttctccaca |
29373434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 32776213 - 32776329
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaac |
225 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||| | |||||||| |||| ||||||||||||||||||| ||||||||| | ||||| ||||||| | |
|
|
| T |
32776213 |
tgtgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcacttctccccaatttaattgtgtgagc |
32776312 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
||||| ||||| ||||| |
|
|
| T |
32776313 |
tctagtcactaagctac |
32776329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 50659584 - 50659708
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||| ||| ||||||||||| |||| |||||||||||||||||| ||||||||| ||| ||| | | |
|
|
| T |
50659584 |
tttatcctcgtgagcttaactcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctcgacaattaaatt |
50659683 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||| ||||| |
|
|
| T |
50659684 |
gtgtgagctctagccactaagctac |
50659708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 19222653 - 19222558
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||| ||| ||||||||| ||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19222653 |
gtgagcttaactcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtga |
19222558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 34740290 - 34740405
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaact |
226 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| | ||| ||||||||||| | || | ||||||||||| |||||| ||||||| || |
|
|
| T |
34740290 |
gtgagtttagcccagttggtagggatattgcatattatatgcatgggccagggttcgaaccctgaactctccacttctccataatttatttgtgtgagct |
34740389 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
34740390 |
ctagccaccaggctac |
34740405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 240
Target Start/End: Original strand, 45198732 - 45198839
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| || |||||||||||| | ||||| | ||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
45198732 |
ttagttcagttggtagggatattgcatattatatgtaggggctgaggttcgaacctcagacactctacttctccacaattaaattgtgtgagctctagcc |
45198831 |
T |
 |
| Q |
233 |
actaggct |
240 |
Q |
| |
|
|||||||| |
|
|
| T |
45198832 |
actaggct |
45198839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 196
Target Start/End: Original strand, 45871014 - 45871088
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||| | || |||||||||||||||||| |
|
|
| T |
45871014 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgcaggggtcggggttcgaaccccggacac |
45871088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 118 - 242
Target Start/End: Original strand, 14795104 - 14795229
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-ata |
216 |
Q |
| |
|
|||| |||| ||||| |||||| ||||||||| || |||||||| |||||||||| ||| ||||| ||||||||||||||||||||||||||||| | | |
|
|
| T |
14795104 |
atttgtccccgtgagcttagcttagttggtagtgacattgcataatatatgcaggtgccagggttcaaaccccggacaccccacttctccacatttaaaa |
14795203 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||| | ||||| |||||| |
|
|
| T |
14795204 |
tgtgtgagctccaaccactcggctac |
14795229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 29098688 - 29098809
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| |||| ||| |||||||||||| ||||||| |||||||||||||| | || |||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
29098688 |
tatccccgtgaacttaactcagttggtagagatattgtatattatatgcaggggtcggggttcgaaccccggacaccccatttctccatatttaattgtg |
29098787 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
| | |||||||||||| |||| |
|
|
| T |
29098788 |
taagttctagccactagactac |
29098809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 223
Target Start/End: Original strand, 43280077 - 43280166
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||||||| |||| ||||| |||||||| | |||||||| |||| |||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43280077 |
ttagctcaattggcagggacattgcataatttatgcaggggccggggttcgaatcccggacaccccacttctccacatttaaatgtgtga |
43280166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 44625298 - 44625177
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
44625298 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
44625199 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|| ||| | |||||||||||| |
|
|
| T |
44625198 |
ggagctccaaccactaggctac |
44625177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 238
Target Start/End: Original strand, 52945892 - 52946008
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| | || |||||||| |||| |||| |||||||||||| ||||| ||| |
|
|
| T |
52945892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaa-cccgtacactccacttctccacaatttaattgta |
52945990 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| ||||| |||||||| |
|
|
| T |
52945991 |
tgagctctaaccactagg |
52946008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 2390414 - 2390306
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| | | ||||||||| ||| | ||||||| |||||||| |
|
|
| T |
2390414 |
tagctcagttgatagggatattgcatattatatgcaggagctagggttcgaaccccggacactcaatttctccacaattaaattgtgtgagctctagccg |
2390315 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
2390314 |
ttaggctac |
2390306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 3614148 - 3614032
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtgtgaac |
225 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||||||| | |||||||| || | |||||||||||| ||||||||||||||||| |||| | |||||||| | |
|
|
| T |
3614148 |
tgtgagcttagctctgttggtagggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccatatttgtaatgtgtgatc |
3614049 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|| || ||||||||||| |
|
|
| T |
3614048 |
tccagtcactaggctac |
3614032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 31316628 - 31316752
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||| ||||||||||| ||||||||| || ||||||| |||||||| ||||| || |||||||||||| ||| | | |
|
|
| T |
31316628 |
tttatccccgtgagcttagctcagttgatagggatattgtatattatatacaagagccgatgttcgaactccggatacttcacttctccacaattaaatt |
31316727 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
| |||| ||||||||||||| |||| |
|
|
| T |
31316728 |
gggtgagctctagccactagactac |
31316752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 44685241 - 44685121
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| |||||| ||||||||| ||||||||||||||||| ||| || ||| |||||||||| |||||||||||||||||| ||| ||||| |
|
|
| T |
44685241 |
atccccgtgagcttagcttagttggtagagatattgcatattatatataggggctgagattcgaaccccaaacaccccacttctccacaattaattgtgt |
44685142 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |||| |
|
|
| T |
44685141 |
gagttctagccactagactac |
44685121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 46767345 - 46767461
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaac |
225 |
Q |
| |
|
||||| || |||||||||||||||| | ||||| ||||||||||| || ||||||| ||||||||||| ||||||||||||||||| | |||||||| | |
|
|
| T |
46767345 |
gtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctgaggttcaaaccccggacatcccacttctccacatttaaaatgtgtgagc |
46767444 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
46767445 |
tccagccactaggctac |
46767461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 47098525 - 47098633
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||| |||||| |||| ||| | |||||||| ||||||||||||||||| |||||| |||||||||||||||| | ||||| ||| ||||| |
|
|
| T |
47098525 |
ttagctcagttgatagggacattgtataatttatgcaggggccgaggttcgaaccccagacacctcacttctccacatttaattatgtgagctccagcca |
47098624 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
47098625 |
ctagactac |
47098633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 130 - 241
Target Start/End: Complemental strand, 52434732 - 52434620
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactct |
228 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||| | || |||||||||||||||||| ||||||||| || ||||| || |||| |||| |
|
|
| T |
52434732 |
gagtttagttcagttggtagggatattgcatattatatacagaggacggggttcgaaccccggacactccacttctcaacaatttaattgagtgagctct |
52434633 |
T |
 |
| Q |
229 |
agccactaggcta |
241 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
52434632 |
aaccactaggcta |
52434620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 234
Target Start/End: Complemental strand, 4200656 - 4200545
Alignment:
| Q |
124 |
ccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtg |
222 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||| | || |||||||||||| ||||| | | ||||||||| ||| | |||||| |
|
|
| T |
4200656 |
ccctgtgaacttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccagacactcaatttctccacaattaaattgtgtg |
4200557 |
T |
 |
| Q |
223 |
aactctagccac |
234 |
Q |
| |
|
| |||||||||| |
|
|
| T |
4200556 |
acctctagccac |
4200545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 148 - 242
Target Start/End: Complemental strand, 5641661 - 5641566
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||| |||||||| ||||||| |||| ||| | ||||||| |||||||||||| ||||| |
|
|
| T |
5641661 |
agggatattgcatattatatgcaggggccggggttcgaacctcggacacctcacttcttcacaattaaattgtgtgagctctagccactaagctac |
5641566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 238
Target Start/End: Original strand, 15299075 - 15299186
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||| || || |||||||| ||||||| ||||||||| || ||||| ||||||| || |
|
|
| T |
15299075 |
gtgagtttagttcagttggtagggatattgtatattatatgcagcagtcggagttcgaacttcggacactccacttctctacaatttaattgtgtgagct |
15299174 |
T |
 |
| Q |
227 |
ctagccactagg |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15299175 |
ctagccactagg |
15299186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 129 - 208
Target Start/End: Original strand, 20489819 - 20489898
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgcaggggccggagttcgaaccccggacacccaactactcca |
20489898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 138 - 241
Target Start/End: Original strand, 32401504 - 32401606
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||||||||| |||| ||| | |||||||| | || ||||||||||||||||||||||| |||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
32401504 |
ctcagttggtagggacattgtataatttatgcaggggtcg-ggttcgaaccccggacaccccacatctccacatttaattgtgtgagctccagccactag |
32401602 |
T |
 |
| Q |
238 |
gcta |
241 |
Q |
| |
|
|||| |
|
|
| T |
32401603 |
gcta |
32401606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 238
Target Start/End: Complemental strand, 46845043 - 46844928
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| |||||||| |||| ||||| |||||||| | |||||||| | || ||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
46845043 |
tccccgtgagcttagctcaattggcagggacattgcataatttatgcaggggtcggagttcgaaccccggacaccctacttctccacatttaaatgtgtg |
46844944 |
T |
 |
| Q |
223 |
aactctagccactagg |
238 |
Q |
| |
|
| ||| ||| |||||| |
|
|
| T |
46844943 |
agctccagctactagg |
46844928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 48546176 - 48546291
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||| ||| || ||||||||||||||||||| |||||||| ||| ||| | ||||||| || |
|
|
| T |
48546176 |
gtgagcttagctcagttggtagtgatattgcatattatatgtagggatcggggttcgaaccccggacacctcacttctctacaattaaattgtgtgagct |
48546275 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||| ||||| |
|
|
| T |
48546276 |
ctaaccactaagctac |
48546291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 127 - 210
Target Start/End: Complemental strand, 54021402 - 54021320
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
54021402 |
tgtgagcttagctcagttggtatggatattgcatattatatgcagg-gccggagttcgaaccccagacaccccgcttctccaca |
54021320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 8762153 - 8762031
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| || |||||||||||||||| ||||||||||||||| | || |||||||||| |||||||||||||||||||| ||| | |||| |
|
|
| T |
8762153 |
atccccgtgagcttaacttagttggtagggatattacatattatatgcaggtgtcggggttcgaaccatggacaccccacttctccacaattaaattgtg |
8762054 |
T |
 |
| Q |
221 |
tga-actctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
8762053 |
tgaggctctagccactagactac |
8762031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 23653283 - 23653169
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| ||||||||||| | | |||||||| |||||||||| | || ||||||||||||| ||||| ||||| |||||||| | |||||||| ||| |
|
|
| T |
23653283 |
gtgagcttaactcagttggtaagaacattgcataatatatgcaggggtcggggttcgaaccccgaacacctcacttatccacattaaaatgtgtgagctc |
23653184 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
23653183 |
tagccactagactac |
23653169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 129 - 234
Target Start/End: Complemental strand, 36625237 - 36625131
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||| |||| |||||||| ||| ||| | ||||||| ||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagttggggttcgaactccgaacactccacttctttacagttaaattgtgtgagctc |
36625138 |
T |
 |
| Q |
228 |
tagccac |
234 |
Q |
| |
|
||||||| |
|
|
| T |
36625137 |
tagccac |
36625131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 49750473 - 49750387
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||| || | |||||||| || |||||||||||||| |||||||| |
|
|
| T |
49750473 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggggctggggttcgaattccagacaccccacttcttcacattta |
49750387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 51155158 - 51155044
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||||| |||||| |||||||||| ||| || | |||||||||| | ||||||||||||||||||| ||| | ||||||| ||| |
|
|
| T |
51155158 |
tgagcttagctcagttggtaggaatattggatattatatgtaggggctggggttcgaacctccgacaccccacttctccacaattaaattgtgtgagctc |
51155059 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| | |||||||||| |
|
|
| T |
51155058 |
taactactaggctac |
51155044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 7938363 - 7938247
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata--tgtgtgaac |
225 |
Q |
| |
|
||||| ||| ||||||||||||||||||| ||| ||||||| ||| | || |||||||||||| ||||| ||||||||||||| ||| | ||||||||| |
|
|
| T |
7938363 |
gtgagcttaactcagttggtagggatattacattttatatgtaggggtcggggttcgaaccccagacactccacttctccacaattaaaattgtgtgaac |
7938264 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
||||| || |||||||| |
|
|
| T |
7938263 |
tctagtcattaggctac |
7938247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 13018798 - 13018907
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||| ||||||| ||| |||||||||||||||||||||| || |||||||||| || ||| || ||||||||||||| ||| | ||| |||||||||||| |
|
|
| T |
13018798 |
ttagttcagttgatagagatattgcatattatatgcaggggctgaggttcgaatcctggatactccacttctccacaattaaattgtttgaactctagcc |
13018897 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
13018898 |
actagactac |
13018907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 150 - 242
Target Start/End: Original strand, 17729016 - 17729109
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||| | || ||||||||||| |||||| ||||||||||||| ||| | ||||||| ||||||||||||| |||| |
|
|
| T |
17729016 |
ggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactagactac |
17729109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 150 - 242
Target Start/End: Original strand, 19030245 - 19030338
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||| | || ||||||||||| |||||| ||||||||||||| ||| | ||||||| ||||||||||||| |||| |
|
|
| T |
19030245 |
ggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagccactagactac |
19030338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 138 - 223
Target Start/End: Original strand, 22857407 - 22857492
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| ||| || ||||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
22857407 |
ctcagttggtaggaatattgcatattatatgcagaggccgatgtttgagccccgaacaccccacttttccacatttaaatgtgtga |
22857492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 25833832 - 25833940
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| || |||||||||| || |||| |||||| |||||| ||| | ||||||| |||||| | |
|
|
| T |
25833832 |
ttagctcagttggtaaagatattgcatattatatgcaggag-cggggttcgaacctcgaacactccacttatccacaattaaattgtgtgagctctagtc |
25833930 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
25833931 |
actaggctac |
25833940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 31673306 - 31673202
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||| ||| |||| ||||||||||||| ||| | || |||| ||||||| |||| |
|
|
| T |
31673306 |
ctcagttggtaaggatattgcatattatatgcaggagccggggttcgaatccc-aacactccacttctccacaattaaattgcgtgagctctagctacta |
31673208 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
31673207 |
ggctac |
31673202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 36666458 - 36666578
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtg |
220 |
Q |
| |
|
||||| ||||| |||| |||||||| ||| |||||| |||||||||||||| ||| | |||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
36666458 |
atccccgtgagcttagttcagttggcaggaatattgtatattatatgcaggggccc-gattcgaaccccagacaccccacttctccacatttataatgta |
36666556 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| ||||||| |||| |
|
|
| T |
36666557 |
tgagctctaaccactagactac |
36666578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 41710580 - 41710701
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||| ||||||| |||| |||||||| |||||||||| ||||||||||||||| | ||||| |
|
|
| T |
41710580 |
tccccgtgagctttgctcagttggtagggacaaatgcattttacatgcaggggccggggttcgaatcccggacacctcacttctccacatttaaaatgtg |
41710679 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
41710680 |
tgagctccagccactaggctac |
41710701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 49408771 - 49408892
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||| |||||||||||||||||| || |||||||||| ||| || ||||||||||| | ||| | | | |
|
|
| T |
49408771 |
tatccccgtgagcttagctcagctggtagggatatcgcatattatatgcaggagtcggggttcgaacctcgggcattccacttctccaaaattaaatttt |
49408870 |
T |
 |
| Q |
220 |
gtgaactctagccactaggcta |
241 |
Q |
| |
|
|||| ||||||||||| ||||| |
|
|
| T |
49408871 |
gtgagctctagccactgggcta |
49408892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 128 - 208
Target Start/End: Original strand, 8125642 - 8125722
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||| | ||||||||| |
|
|
| T |
8125642 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggaccggggttcgaattccggacactctacttctcca |
8125722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 19879215 - 19879319
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||| ||||||||||| | ||| ||||||||||| |||| ||||||||||||| ||||||||||||| |||| ||| | ||||||| |||||||||||| |
|
|
| T |
19879215 |
tcagctggtagggatactacattttatatgcaggggccggggttcgaaccccgaacaccccacttcttcacaattaaattgtgtgagctctagccactat |
19879314 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
19879315 |
gctac |
19879319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 174 - 242
Target Start/End: Original strand, 23398920 - 23398988
Alignment:
| Q |
174 |
gccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||| | |||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
23398920 |
gccggggttcgaaccctgcacaccccacttctccacatttatatgcgtgagctctagccactaggctac |
23398988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 129 - 241
Target Start/End: Original strand, 28951720 - 28951832
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| ||| |||| |||| | ||| |||||||| | |||||||| || | |||||||||||| |||||||||| ||| |||||||| |||||||| |||| |
|
|
| T |
28951720 |
tgagcttaactcaattggcaaggacattgcataatttatgcaggggctggggttcgaaccccagacaccccacatcttcacatttaaatgtgtgagctct |
28951819 |
T |
 |
| Q |
229 |
agccactaggcta |
241 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28951820 |
agccactaggcta |
28951832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 143 - 242
Target Start/End: Complemental strand, 44764621 - 44764522
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||| |||||||||| ||||| ||||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
44764621 |
ttggtagggatattgcatttcatatgcaggggccgagattcgaacccc-gacactccacttctccataatttaattgtgtgagctctagccactaggcta |
44764523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 46336570 - 46336454
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtgtgaac |
225 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||| |||||||||| | || ||||||||||||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
46336570 |
gtgagcttagctcagttggtagggataaatacataatatatgcaggggtcggggttcgaaccccgaacaccccacttttccacattatatatgtgtgagt |
46336471 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|| | |||||||||||| |
|
|
| T |
46336470 |
tccaaccactaggctac |
46336454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 50727320 - 50727196
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||| |||| ||||||| ||| |||| | ||||||||||| |||| ||||||||| ||| ||| | | |
|
|
| T |
50727320 |
tttatccccgtgagcctaactcagttggtagggatatcgcattttatatgaaggggccgggattcgaaccccgaacactccacttctcgacaattaaatt |
50727221 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||| ||||| |
|
|
| T |
50727220 |
gtgtgagctctagccactaagctac |
50727196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 50785528 - 50785652
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||| |||| ||||||| ||| |||| | ||||||||||| |||| ||||||||| ||| ||| | | |
|
|
| T |
50785528 |
tttatccccgtgagcctaactcagttggtagggatatcgcattttatatgaaggggccgggattcgaaccccgaacactccacttctcgacaattaaatt |
50785627 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||| ||||| |
|
|
| T |
50785628 |
gtgtgagctctagccactaagctac |
50785652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 51425834 - 51425958
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| ||| |||||||||||||||||| ||| ||||||||||| |||| ||||||||||| |||||| |||||||| ||| ||| | | |
|
|
| T |
51425834 |
tttatccccgtgagcttaactcagttggtagggatatcacattttatatgcaggggccggggttcgaaccctggacacttcacttctcgacaattaaatt |
51425933 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||| ||||| ||||| |
|
|
| T |
51425934 |
gtgtgagctctagtcactaagctac |
51425958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 236
Target Start/End: Complemental strand, 9220313 - 9220211
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||| ||||||||||||| | || ||||||||||||| || |||||||||||||||||| |||| |||||||| ||| | ||||||| |||||||| |
|
|
| T |
9220313 |
ttagctcaattggtagggatatcgtattttatatgcaggagtcggggttcgaaccccggacactccac-tctccacaattaaattgtgtgagctctagcc |
9220215 |
T |
 |
| Q |
233 |
acta |
236 |
Q |
| |
|
|||| |
|
|
| T |
9220214 |
acta |
9220211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 9685006 - 9685113
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccac |
234 |
Q |
| |
|
||||||| |||| ||||| |||||||| | |||||||| || | |||||||| |||| |||| ||||||||||| ||||| |||||||| ||| |||||| |
|
|
| T |
9685006 |
tagctcaattggcagggacattgcataatttatgcaggggctggggttcgaatcccgaacactccacttctccatatttaaatgtgtgagctccagccac |
9685105 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
9685106 |
taggctac |
9685113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 40963786 - 40963663
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| ||| |||||||| || ||||||||||| ||||||||||| | || ||||||||||||||||| || ||||||||| ||||| || |
|
|
| T |
40963786 |
ttatccccgtgagcttaactcagttgataaggatattgcattttatatgcaggggtcggggttcgaaccccggacaatcctcttctccacaatttaattg |
40963687 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||| |||| |||| |
|
|
| T |
40963686 |
tgtgagctctagcctctagactac |
40963663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 223
Target Start/End: Original strand, 43645078 - 43645173
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||||||| ||||||||| || |||||||| | |||||||||||||||||||||| | |||||| |
|
|
| T |
43645078 |
gtgagcttagctcagttgacagggatatttcatattatacgcaggagccaagattcgaacctcaaacaccccacttctccacatttaaacgtgtga |
43645173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 119 - 237
Target Start/End: Original strand, 44364015 - 44364133
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atat |
217 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||| | | |||||||||||||| | ||||||| | ||||||| | || |
|
|
| T |
44364015 |
tttatccccgtgagtttaactcagttggtagggatattgcatattatatgcagaggtctgagttcgaaccccggata-cccactttttcacatttaaaat |
44364113 |
T |
 |
| Q |
218 |
gtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||| || ||||||| |
|
|
| T |
44364114 |
gtgtgaactttaaccactag |
44364133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 148 - 242
Target Start/End: Original strand, 48722267 - 48722362
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||| | || |||||||||||||||||||| | ||||| ||| ||| | ||||||| |||||||||||| ||||| |
|
|
| T |
48722267 |
agggatattgcatattatatgcaggggtcggggttcgaaccccggacaccctatttctctacaattaaattgtgtgagctctagccactaagctac |
48722362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 131 - 242
Target Start/End: Complemental strand, 54408614 - 54408503
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctag |
230 |
Q |
| |
|
||||||||||| |||| ||||| |||||||| | ||||||| | || |||||||||||||||||||||| || |||||||||| | ||||| ||||| |
|
|
| T |
54408614 |
agtttagctcatttggcagggacattgcataatttatgcagaggtcggggttcgaaccccggacaccccatttttccacatttaattatgtgagctctaa |
54408515 |
T |
 |
| Q |
231 |
ccactaggctac |
242 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54408514 |
ccactaggctac |
54408503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 134 - 228
Target Start/End: Original strand, 53203833 - 53203927
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||| || | || |||||||||| ||| ||||||| ||||||||||||||| ||||||| |||| |
|
|
| T |
53203833 |
ttagctcagttggtagggatattgcataatttatacaagggctgaggttcgaatcccagacacccaacttctccacatttaattgtgtgagctct |
53203927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 241
Target Start/End: Complemental strand, 7253587 - 7253474
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||| ||| |||||||||| |||||||| | |||||||| | |||||| ||||||||||||||||||||||| |||||| ||||||| | |
|
|
| T |
7253587 |
gtgaggttagatcaattggtagggacattgcataatttatgcagggatcaaggttcaaaccccggacaccccacttctccgcatttaattgtgtgagccg |
7253488 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7253487 |
tagccactaggcta |
7253474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 10349402 - 10349518
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||| ||||||||||| || | |||||||| ||||||| ||||||||||||| ||| | |||| |
|
|
| T |
10349402 |
atccccgtgagcttagctcagttgatagggatattgc-----atatgcaggagtcgggtttcgaacctcggacactccacttctccacaattaaattgtg |
10349496 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
10349497 |
tgagctctaaccactaggctac |
10349518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 11234439 - 11234560
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||| |||| ||||||| || |||||||||||||| | |||||||||||| |||| ||||||||||||| || | |||| |
|
|
| T |
11234439 |
atccccgtgagcttagctcagttagtagagatattgtattttatatgcaggagctggggttcgaaccccagacaatccacttctccacaaataaattgtg |
11234538 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| ||| |||| |
|
|
| T |
11234539 |
tgagctctagccattagactac |
11234560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 15005944 - 15006053
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca-ccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
||||||||||||||||||| || | |||||||| | ||||||||||||| ||||||||| ||||||| || |||||||||||||||| || |||| || |
|
|
| T |
15005944 |
gtgagtttagctcagttggcagaaacattgcataatttatgcaggagccggggttcgaactccggacatccacacttctccacatttaattgagtgagct |
15006043 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
||| |||||| |
|
|
| T |
15006044 |
ctaaccacta |
15006053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 15085757 - 15085636
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||| ||||||||||| | ||||| ||||||||||| | || ||||||||||||||||||| |||||||||| |||| | ||||| |
|
|
| T |
15085757 |
tccccgtgagctttgctcggttggtagggacaaatgcattttatatgcaggggtcggggttcgaaccccggacacctcacttctccatatttaaaatgtg |
15085658 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
15085657 |
tgagctccagccactaggctac |
15085636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 15491862 - 15491973
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacccca---cttctccacatttatatgtgtgaactctag |
230 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| | | |||||||||||| ||||||||| |||||||||| | | |||||||| |||||| |
|
|
| T |
15491862 |
ttagctcagttggtagaaatattgcatattatatgcaggggttggggttcgaaccccagacaccccacttcttctccacaataaaatgtgtgagctctag |
15491961 |
T |
 |
| Q |
231 |
ccactaggctac |
242 |
Q |
| |
|
|||||| |||| |
|
|
| T |
15491962 |
tcactagactac |
15491973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 25638446 - 25638341
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||| | |||||||||||| |||||||| | ||||||| ||| ||| | ||||||| ||||||||| || |
|
|
| T |
25638446 |
ctcaattggtagagatattgcatattatatgtaggggtcgaggttcgaacaccggacactcaacttctctacaattaaattgtgtgagctctagccaata |
25638347 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
25638346 |
ggctac |
25638341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 29559740 - 29559655
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| || | || |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatgtagaggtcggggtttgaacttcggacaccccacttctccacattta |
29559655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 121 - 198
Target Start/End: Original strand, 34847539 - 34847616
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccc |
198 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||||||||||||||||||| | || ||||||||| |||||||||| |
|
|
| T |
34847539 |
tatccccgtgagcttaattcagttggtagggatattgcatattatatgcaggggtcggggttcgaactccggacaccc |
34847616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 201
Target Start/End: Original strand, 46880000 - 46880073
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||||||||| |||||||||||||||||| |||| |||| |
|
|
| T |
46880000 |
gtgagcttagctcagttgatagggatattgcattttatatgcagaggccgaggttcgaaccccgaacactccac |
46880073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 49194749 - 49194644
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| ||| | | |||||||||||||||||| ||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
49194749 |
ctcaattggtaggaatattgcatattatatgtaggggtcagggttcgaaccccggacacttcacttctccacaatttaattgtgtgagctctagccacta |
49194650 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
49194649 |
tgctac |
49194644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 54626356 - 54626460
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||| ||||||||||||| |||| ||||||| ||||| || |||||||||||||||||| |||| |||||||| ||| | ||||||| |||||||||||| |
|
|
| T |
54626356 |
ctcaattggtagggatatcgcattttatatgtaggagtcggggttcgaaccccggacactccac-tctccacaattaaattgtgtgagctctagccacta |
54626454 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
| |||| |
|
|
| T |
54626455 |
gactac |
54626460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 196
Target Start/End: Original strand, 2368939 - 2369007
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||| || | |||||||||||| ||||| |
|
|
| T |
2368939 |
gtgagcttagctcagttgttagggatattgcatattatatgcaggggctggggttcgaaccccagacac |
2369007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 147 - 242
Target Start/End: Original strand, 11206012 - 11206108
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||| || | | |||||||| |||||| |||||||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
11206012 |
tagggatattgcatattatatgtagaggttggggttcgaatcccggataccccacttctccacagttaaattgtgtgagctctagccactaggctac |
11206108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 24430149 - 24430267
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatat---gcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtga |
223 |
Q |
| |
|
||||| |||||||||||||||| ||||||| ||||||||| ||||| |||| ||||||| | || |||||||||||||||||| ||| | ||||||| |
|
|
| T |
24430149 |
gtgagcttagctcagttggtagagatattgtatattatatgcagcaggggccggagttcgaatctcgaacaccccacttctccacaattaaattgtgtga |
24430248 |
T |
 |
| Q |
224 |
actctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
24430249 |
gctctagccactagactac |
24430267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 27983851 - 27983967
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
||||| |||||| |||||||||||||||| ||||||||| ||||||||||| | || |||| ||||||| ||||| ||| ||||||||| ||| | ||| |
|
|
| T |
27983851 |
tatccatgtgagcttagctcagttggtagaaatattgcattttatatgcaggggtcggggtttgaaccccagacactccaattctccacaattaaattgt |
27983950 |
T |
 |
| Q |
220 |
gtgaactctagccacta |
236 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
27983951 |
atgagctctagccacta |
27983967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 119 - 203
Target Start/End: Original strand, 28193792 - 28193876
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| |||| ||| ||||||||||||||||||||||| ||||||||||| | || ||| |||||||||||||| |||||| |
|
|
| T |
28193792 |
tttatccccttgagcttaactcagttggtagggatattgcattttatatgcaggggtcggggtacgaaccccggacactccactt |
28193876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 42268798 - 42268902
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||| ||| ||||||||| |||||||||||| ||||| ||| || ||||| ||||||| |
|
|
| T |
42268798 |
tcagttggtagggatattgcatattatatgcaggggccagagtttgaatcccggacactccacttctccacaatttaattgtacgagctctaaccactag |
42268897 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
42268898 |
gctac |
42268902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 44626034 - 44626153
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtaggg--atattgcatattatatgc-aggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtg |
222 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| ||||||||||| ||| || | | |||||||| | ||||| ||||||||||||| |||||| ||||| |
|
|
| T |
44626034 |
tgtgagcttagctcagttggtaggtgtatattgtatattatatgccaggggctgggattcgaacctcagacactccacttctccacaattatattgtgtg |
44626133 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
44626134 |
agctctagccactaggctac |
44626153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 49983769 - 49983662
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||| |||| ||| | |||||||| | | |||||||||||||||||||| ||||||||||| ||| ||||| | ||||||||| |
|
|
| T |
49983769 |
ttagctcagttggtagggacattgtataatttatgcaggggttggggttcgaaccccggacaccctacttctccacaattaattgtgt-agctctagcca |
49983671 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
| ||||||| |
|
|
| T |
49983670 |
caaggctac |
49983662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 242
Target Start/End: Original strand, 26880195 - 26880294
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||| |||||||| | |||||||| | || ||||||||| | ||||||||||||||||||||||| |||||||| ||||| ||| |||||||| |
|
|
| T |
26880195 |
ttggtatggacattgcataatttatgcaggggtcggggttcgaacttcagacaccccacttctccacatttaaatgtgtgagctctaaccattaggctac |
26880294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 117 - 203
Target Start/End: Complemental strand, 27183788 - 27183701
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| |||| ||||| |||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
27183788 |
aatttgtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
27183701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 34847619 - 34847710
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||| | |||| |||||||||| |||| | ||||||||||||||||||||||||| |||| ||||||| |||| |
|
|
| T |
34847619 |
gatattgcatattatatgcatgggccggtgttcgaaccctagacatctcacttctccacatttatatgtgtgagttctaaccactagactac |
34847710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 138 - 237
Target Start/End: Complemental strand, 52992116 - 52992017
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| | | || | ||||||||| ||||||||||||||||| ||||| ||||||| |||||| |||||| |
|
|
| T |
52992116 |
ctcagttggtagggatattgcataatttatgcaagggtcgggattcgaaccctcgacaccccacttctccatatttaattgtgtgagctctagtcactag |
52992017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 188
Target Start/End: Complemental strand, 11250652 - 11250598
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
11250652 |
ttagctcagttggtagggatattgcatattatatgcagggtccggggttcgaacc |
11250598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 125 - 234
Target Start/End: Original strand, 16886582 - 16886692
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtga |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||| ||| |||| |||| | ||| |||| | |||||||||||| ||||| ||| | |||||||| |
|
|
| T |
16886582 |
cctgtgagcttagctcagttggtagggacattgcatattgtatacaggggccgggattcaaacctcagacaccccacttttccacgtttaaaatgtgtga |
16886681 |
T |
 |
| Q |
224 |
actctagccac |
234 |
Q |
| |
|
||| |||||| |
|
|
| T |
16886682 |
gctccagccac |
16886692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 30185050 - 30185131
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||||||| | || ||||| |||| ||||||| ||||||||||||| |
|
|
| T |
30185050 |
gtgagtttagttcagttggtatgcatattgcatattatatgcaggggtcg-ggttcaaacctcggacactccacttctccaca |
30185131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 117 - 242
Target Start/End: Complemental strand, 38819401 - 38819276
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttat |
215 |
Q |
| |
|
|||||||||| ||| |||||| |||||||||||||||| ||||||||||||||| | | ||||| |||||| |||| |||||||||||| ||||| |
|
|
| T |
38819401 |
aatttatccccatgaacttagcttagttggtagggatatttcatattatatgcagggactggggttctaacccc-aacactccacttctccacaatttaa |
38819303 |
T |
 |
| Q |
216 |
atgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||||||| |||| |
|
|
| T |
38819302 |
ttgtgtgagctctagccactagactac |
38819276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 46343922 - 46343808
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| ||||||||||||||| | | |||||| ||| |||| | | ||||||||| |||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
46343922 |
gtgagtttaactcagttggtagggacaatacatattttatacaggggtcagggttcgaactccggacacccaacctcttcacatttaattgtgtgaactc |
46343823 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||| ||| |||| |
|
|
| T |
46343822 |
tagccattagactac |
46343808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 55383955 - 55383869
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| |||||| |||||||||| | |||||||| | ||||||| || | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55383955 |
gtgagcttagcttagttggtaggaacattgcataatttatgcagaggcaggggttcgaacccctgacaccccacttctccacattta |
55383869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 206
Target Start/End: Complemental strand, 1743870 - 1743785
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa-ccccggacaccccacttctc |
206 |
Q |
| |
|
||||| ||||| ||| |||| |||||||||||||||||| ||||||| ||| |||| |||||||| |||||||||| ||||||||| |
|
|
| T |
1743870 |
atccccgtgagcttaactcaattggtagggatattgcattttatatgtaggggccggggttcgaacccccggacactccacttctc |
1743785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 117 - 214
Target Start/End: Complemental strand, 6062894 - 6062797
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| | ||||| |||||| |||||||| |||| | || |||||||||||||| | ||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6062894 |
aatttattcatgtgaatttagcccagttggtggggacaatgtatattatatgcaggggttgagattcgaaccccagacactccacttctccacattta |
6062797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 9624989 - 9625058
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
9624989 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
9625058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 146 - 223
Target Start/End: Original strand, 23939055 - 23939132
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||||| |||||||||||||| | | |||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
23939055 |
gtagggatattacatattatatgcagaggttggggttcgaaccccggacactctacttcttcacatttatatgtgtga |
23939132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 31922369 - 31922473
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||| |||||||| ||| |||| |||||||||||| ||| | || |||| |||||||||||| |
|
|
| T |
31922369 |
ctcagttggtaagaatattgcatattatatgcaggagccggggttcgaatccc-aacacttcacttctccacaattaaattgcgtgagctctagccacta |
31922467 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
31922468 |
agctac |
31922473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 36472504 - 36472383
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtaggga-tattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtg |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||| |||||||||| || | ||||||| || ||| |||||||||||||||| | ||||| |
|
|
| T |
36472504 |
tccctgtgagtttaactcagttggtagggacaaatgcatattgtatgcaggagtcgggattcgaactccaaacaacccacttctccacattaaaaatgtg |
36472405 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| ||||||||| |||| |
|
|
| T |
36472404 |
tgagctccagccactagactac |
36472383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 117 - 233
Target Start/End: Original strand, 39300376 - 39300491
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||| ||| ||||| |||||||| | |||||||||||| ||||| ||| |||| |||| ||| | |
|
|
| T |
39300376 |
aattaatccccgtgagcttagctcagttggtagggatattacattttata-gcaggagctggggttcgaacccc-gacactccatttcttcacaattaaa |
39300473 |
T |
 |
| Q |
217 |
-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
39300474 |
ttgtgtgagctctagcca |
39300491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 45647312 - 45647421
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||| |||| ||| ||||||||| | || ||||||||||||||||||| ||||||| || |||| ||||| ||| ||| | || |
|
|
| T |
45647312 |
ttagctcagttggtagggacattgtataaaatatgcagggggcggggttcgaaccccggacacctcacttcttcatatttaatatgcttgagctccaacc |
45647411 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
45647412 |
actaggctac |
45647421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 196
Target Start/End: Complemental strand, 5326103 - 5326035
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
5326103 |
gtgagcttagctcagttggtagcgatattgcatattacatgcatgagcaagggttcgaaccccggacac |
5326035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 129 - 212
Target Start/End: Original strand, 10828473 - 10828557
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10828473 |
tgagcttagctcagttggtagggacaaatgcatattatatgcagagaccggagttcgaaccccagacaccccacttctccacatt |
10828557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 239
Target Start/End: Complemental strand, 10952365 - 10952261
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccac |
234 |
Q |
| |
|
||||||| |||| ||||| ||| |||| | |||||||| ||| |||||||||||| |||||||||||| ||||| ||| |||||||| ||| |||||| |
|
|
| T |
10952365 |
tagctcaattggcagggacattacataatttatgcaggggcctgggttcgaacccccgacaccccacttatccacgttttaatgtgtgagctccagccac |
10952266 |
T |
 |
| Q |
235 |
taggc |
239 |
Q |
| |
|
||||| |
|
|
| T |
10952265 |
taggc |
10952261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 29496172 - 29496116
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcga |
185 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||| || |||||||||| |
|
|
| T |
29496172 |
tgagtttaactcagttggtagggatattgcatattatatacagaagtcgaggttcga |
29496116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 229
Target Start/End: Complemental strand, 33176513 - 33176406
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||||| |||||||| ||||||| |||| |||||||||||||||| |||||||| | |||||||| | |||||| |||| |||||||||| ||||||| |
|
|
| T |
33176513 |
atccctttgagtttaactcagttagtaga-atattgcatattatatataggagccgggattcgaacctcagacacctcactactccacatttaatatgtg |
33176415 |
T |
 |
| Q |
221 |
tgaactcta |
229 |
Q |
| |
|
|||| |||| |
|
|
| T |
33176414 |
tgaattcta |
33176406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 34102063 - 34102155
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| || | ||||||||||||||||||| || ||||||||||||| |
|
|
| T |
34102063 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctggggttcgaaccccggacacctcatttctccacattta |
34102155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 36934338 - 36934446
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||| ||| |||||| |||||||||||||||||| ||| | ||| |||||||| | |||||||| || |||||||||||| ||||| ||||||||| |
|
|
| T |
36934338 |
ttagttcaattggtatagatattgcatattatatgtaggggtcgatgttcgaacactaaacaccccatttttccacatttatacatgtgagctctagcca |
36934437 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
36934438 |
ctaggctac |
36934446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 205
Target Start/End: Complemental strand, 38562243 - 38562159
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
||||| |||||| ||| |||| ||| || ||||||||||||||||||||||||| || ||||||||||| ||||| |||||||| |
|
|
| T |
38562243 |
tatccatgtgagcttacctcaattgataaggatattgcatattatatgcaggagtcggagttcgaacccctgacactccacttct |
38562159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 201
Target Start/End: Original strand, 39169758 - 39169837
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
|||||||||||| ||| ||||||| |||| ||||||||||| |||||||||| |||| ||||||||||||| |||| |||| |
|
|
| T |
39169758 |
tatccctgtgagcttaactcagttagtagagatattgcata-tatatgcaggggccggggttcgaaccccgaacactccac |
39169837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 229
Target Start/End: Complemental strand, 40723717 - 40723625
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactcta |
229 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | || | |||||||||| |||||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
40723717 |
ctcagttggtagggatattgcatgttatatgcggaggctggggttcgaaccttagacacctcacttctccacatttaaaatgtgtgaactcta |
40723625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 42785895 - 42785983
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| ||| ||||||||||| ||||||| ||||| |||||||| | || ||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
42785895 |
ctgtgagcttaactcagttggtaaggatattatatattttatgcaggggtcggggttcgaaccctggacaccctacttctccacgttta |
42785983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 195
Target Start/End: Complemental strand, 11236494 - 11236428
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | ||||||||||| |||| |||||||||| |||||| |
|
|
| T |
11236494 |
gtgagtttagctcagttggtaggaatattgctttttatatgcagg-gccggggttcgaacctcggaca |
11236428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 129 - 212
Target Start/End: Original strand, 19882689 - 19882771
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||| ||||||| || ||| ||| ||| |||||||||||||||| |
|
|
| T |
19882689 |
tgagtttagctcggttggtagggatattgcatgttatatgcattggccgagg-tcaaactccgaacatcccacttctccacatt |
19882771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 238
Target Start/End: Original strand, 27668925 - 27669035
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||| ||| ||||||||| ||| ||| ||||||||| ||| || |||||||||||||||||| |||| |||||||| ||| | ||||||| || |
|
|
| T |
27668925 |
gtgagcttagttcaattggtaggggtatcacattttatatgcaagagtcggggttcgaaccccggacactccac-tctccacaattaaattgtgtgagct |
27669023 |
T |
 |
| Q |
227 |
ctagccactagg |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27669024 |
ctagccactagg |
27669035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 156 - 242
Target Start/End: Complemental strand, 41253788 - 41253701
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||| ||||| ||||| |||| |||| | |||||||| ||| |||||||||||||| |
|
|
| T |
41253788 |
tgcattttatatgcaggggccggggttcgaaccccgaacacctcacttttccatatttaaaatgtgtgagctccagccactaggctac |
41253701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 41411671 - 41411580
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| | |||||||| || ||||| ||||||||||||||| |||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
41411671 |
gatattgcataatttatgcagggttcggggttcaaaccccggacaccccgcttctccacatttaattgtgtgagttctagccactaagctac |
41411580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 49029011 - 49028924
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| || |||||||||||||||| | ||||| ||||||||||| ||| ||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
49029011 |
gtgagctttgctcagttggtagggacaaatgcattttatatgcagggaccggggttcgaaccccgaacactccacttctccacattta |
49028924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 185
Target Start/End: Complemental strand, 50536905 - 50536842
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcga |
185 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||||||||||||||||||| | || ||||||| |
|
|
| T |
50536905 |
atccccgtgagcttagctcagttggtagagatattgcatattatatgcaggtgtcggggttcga |
50536842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 127 - 198
Target Start/End: Original strand, 51772891 - 51772962
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccc |
198 |
Q |
| |
|
|||||| ||| || |||||||||||||||||||||||||||||||| | || |||||||||| | ||||||| |
|
|
| T |
51772891 |
tgtgagcttaacttagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcagacaccc |
51772962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 156 - 242
Target Start/End: Original strand, 53906410 - 53906497
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||| |||| |||| ||||||||||||| ||||| |||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
53906410 |
tgcattttatatgcaggggccggggtttgaaccccggacacttcacttttccacaattaaattgtgtgagctctagccactaggctac |
53906497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 210
Target Start/End: Complemental strand, 54349892 - 54349825
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| | || |||| |||| |||||||| |||||||||||| |
|
|
| T |
54349892 |
ttggtagggatattgcatattatatgcaggggtcggagttcaaacctcggacacctcacttctccaca |
54349825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 123 - 201
Target Start/End: Complemental strand, 4237051 - 4236974
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
|||| ||||| |||| |||||||||||||| |||||||| | |||||||| | || ||||||||||||||||||||||| |
|
|
| T |
4237051 |
tccccgtgagcttagttcagttggtagggacattgcataatttatgcagg-ggcggggttcgaaccccggacaccccac |
4236974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 120 - 210
Target Start/End: Original strand, 14005014 - 14005104
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||| || |||||||||| ||||| ||||||| || | |||| ||| ||||||||| |
|
|
| T |
14005014 |
ttatccccgtgagtttagctcagttggtagagatattatattttatatgcagtggccgatgttcgaatcctgaacactccatttctccaca |
14005104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 233
Target Start/End: Original strand, 17765580 - 17765686
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||| | |||||||||||||||| ||||||||||||| | || |||||||||||| | |||||||||||||| | |||| || ||||| || |
|
|
| T |
17765580 |
gtgagcttagcccggttggtagggatattgtatattatatgcagcggttgaagttcgaaccccgaaaaccccacttctccatattttaaatatgtgagct |
17765679 |
T |
 |
| Q |
227 |
ctagcca |
233 |
Q |
| |
|
||||||| |
|
|
| T |
17765680 |
ctagcca |
17765686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 233
Target Start/End: Original strand, 19066900 - 19067006
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||| | |||||||||||||||| ||||||||||||| | || |||||||||||| | |||||||||||||| | |||| || ||||| || |
|
|
| T |
19066900 |
gtgagcttagcccggttggtagggatattgtatattatatgcagcggttgaagttcgaaccccgaaaaccccacttctccatattttaaatatgtgagct |
19066999 |
T |
 |
| Q |
227 |
ctagcca |
233 |
Q |
| |
|
||||||| |
|
|
| T |
19067000 |
ctagcca |
19067006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 208
Target Start/End: Complemental strand, 32732598 - 32732524
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||| | ||||||||||||| |||| ||||||||||| | || ||||||||| |||||||| ||||||||||| |
|
|
| T |
32732598 |
ttagcttaattggtagggatatcgcattttatatgcaggggtcggggttcgaactccggacactccacttctcca |
32732524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 236
Target Start/End: Original strand, 35849510 - 35849592
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||| | |||||||| |||| |||||||||||| ||||||||||||||| |||||| ||||||| ||| |||||||| |
|
|
| T |
35849510 |
attgcataatttatgcaggggccggggttcgaaccccaaacaccccacttctccccatttaattgtgtgagctccagccacta |
35849592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 120 - 195
Target Start/End: Complemental strand, 42541894 - 42541817
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtaggga--tattgcatattatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
|||||| ||||| |||||||||||||||| || |||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
42541894 |
ttatccatgtgaacttagctcagttggtagagagatattgcatattatatgcaggggccgaggttcgaattccggaca |
42541817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 45118644 - 45118718
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||| |||||||||| |||| ||||||||||| ||| |||||||| |
|
|
| T |
45118644 |
tgagcttagctcagttggtagggacattgcattatatatgcaggggccggggttcgaacccgggattccccactt |
45118718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 45513069 - 45512947
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| || || ||||||||||| ||| |||||||||||||||||| |||||| | |||| ||||| || |||| |||||||||||| ||| | ||| |
|
|
| T |
45513069 |
tatccccgtaagcttagctcagttagtatggatattgcatattatatacaggagttggggtttgaaccacgaacactacacttctccacaattaaattgt |
45512970 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| ||||||| |||| |
|
|
| T |
45512969 |
gtgagctctaaccactagactac |
45512947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 138 - 237
Target Start/End: Complemental strand, 46176859 - 46176758
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgag-gttcgaaccccggaca-ccccacttctccacattt-atatgtgtgaactctagccac |
234 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| | || |||||||||||||||| ||||| |||||||||||| | ||||||||| ||||||||| |
|
|
| T |
46176859 |
ctcaattggtatggatattgcatattatatgcagg-gattagagttcgaaccccggacacccccatttctccacatttaaaatgtgtgaattctagccac |
46176761 |
T |
 |
| Q |
235 |
tag |
237 |
Q |
| |
|
||| |
|
|
| T |
46176760 |
tag |
46176758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 49375748 - 49375662
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||| ||||||||||||||| ||| |||| | |||||||| || | ||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
49375748 |
gtgagcttaactcagttggtagggacattacataatttatgcaggggctggcgttcgaaccccggacactccacttcaccacattta |
49375662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 209
Target Start/End: Complemental strand, 11236376 - 11236295
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
||||| |||||||||||||||| |||||| | |||||||||||||||| |||||||| || ||||| |||||||||||| |
|
|
| T |
11236376 |
gtgagcttagctcagttggtagaaatattgttttttatatgcaggagccggagttcgaacaccagacactccacttctccac |
11236295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 205
Target Start/End: Complemental strand, 13644767 - 13644690
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||| | || ||||||||| | | |||| |||||||| |
|
|
| T |
13644767 |
gtgagtttatctcaattggtagggatattgtatattatatgcaggggtcggggttcgaactcagtacactccacttct |
13644690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 14868691 - 14868760
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
14868691 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccactt |
14868760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 16906895 - 16906823
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||| || || || ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
16906895 |
gctcagttgctagggatattgcatattatgtggagaggctgagattcgaa-cccggacaccccacttctccaca |
16906823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 241
Target Start/End: Complemental strand, 18764934 - 18764822
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||| |||| | ||| |||||||| | ||||||| | | ||||||||| | |||||||| ||||||| ||||||| |||||||| ||| |
|
|
| T |
18764934 |
gtgagcttagctcaattggcaaggacattgcataatttatgcagtggtcagggttcgaacactggacaccc-acttctctacatttaaatgtgtgagctc |
18764836 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18764835 |
tagccactaggcta |
18764822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 189
Target Start/End: Complemental strand, 20887836 - 20887775
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||| || | | ||||||||| |
|
|
| T |
20887836 |
gtgagtttagctcagttggtagggatattgcataatttatgcaggggcagggattcgaaccc |
20887775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 24559395 - 24559464
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| | ||||||| |||||| ||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
24559395 |
tagctcagttagcagggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccactt |
24559464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 143 - 212
Target Start/End: Original strand, 25934064 - 25934132
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||| || |||||||||| || |||||||||||||||||| |
|
|
| T |
25934064 |
ttggtagagatattgcatattatatgcaggagtcggtattcgaacccc-gaaaccccacttctccacatt |
25934132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 28396848 - 28396767
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||| | || |||||| | |||| |||| | ||||||||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatgcaggggtcggggttcgtatcccgaacacgctacttctccaca |
28396767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 42496435 - 42496355
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| ||| | || |||||||||||| |||||| ||||||||||| |
|
|
| T |
42496435 |
tgagtttagcttagttggtagaaatattgcatattatatgtaggggtcg-ggttcgaaccccaaacaccctacttctccaca |
42496355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 207
Target Start/End: Complemental strand, 1697915 - 1697835
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
||||| ||| ||||||| |||||||||||||||| ||||||||||| | | ||||| ||||| ||||||||||||||||| |
|
|
| T |
1697915 |
gtgagcttaactcagttagtagggatattgcatatttatatgcaggggtcagggttcaaaccctggacaccccacttctcc |
1697835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 4808112 - 4807997
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcag-gagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaac |
225 |
Q |
| |
|
|||||||||||||||||| ||| ||||| | ||| ||||| ||| ||| ||||||||||||| | |||||||||||||| |||||| | |||||||| | |
|
|
| T |
4808112 |
gtgagtttagctcagttgctagagatatcgtataatatatccagtgagt-gaggttcgaaccctgaacaccccacttctctacatttaaaatgtgtgagc |
4808014 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||| |||| |
|
|
| T |
4808013 |
tctaaccactagactac |
4807997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 223
Target Start/End: Original strand, 11995129 - 11995229
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| |||| ||||||| |||||| |||||||| | |||| || |||||||||| ||| ||||||||| || ||||||||||||| |||||| |
|
|
| T |
11995129 |
tccccgtgagcttagttcagttgatagggacattgcataatttatgtagaggccgaggttcaaactccggacacctcatttctccacatttaattgtgtg |
11995228 |
T |
 |
| Q |
223 |
a |
223 |
Q |
| |
|
| |
|
|
| T |
11995229 |
a |
11995229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 238
Target Start/End: Original strand, 14887256 - 14887344
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||| ||||||||||||||| | || ||||||||||| | |||| |||||||||||| ||||| ||| ||| |||||||||||||| |
|
|
| T |
14887256 |
gatattacatattatatgcaggggtcggggttcgaaccctgtacactccacttctccacaatttaattgtatgagctctagccactagg |
14887344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 203
Target Start/End: Original strand, 17003820 - 17003880
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
17003820 |
ttggcagggacattgcataatatatgcaggatccgaggtttgaacaccggacaccccactt |
17003880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 235
Target Start/End: Complemental strand, 17472373 - 17472289
Alignment:
| Q |
152 |
atattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||| |||| || ||| ||||||||| ||| | ||||||| ||||||||||| |
|
|
| T |
17472373 |
atattgcatattatatgcaggagctgggattcgaacctcggatactccaattctccacaattaaattgtgtgagctctagccact |
17472289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 33206764 - 33206869
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| || | ||||||||||||||||||||||||| | ||| ||||| | ||||| |||||||| |
|
|
| T |
33206764 |
tagctcagttggtagg-acaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcac-cttataag-gtgaattctagcca |
33206860 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
33206861 |
ctaggctac |
33206869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 36763427 - 36763506
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| || |||||||||||||||| |||||||| |||||||||| |||| ||| ||| |||||||||||||||| |
|
|
| T |
36763427 |
tccccgtgagcttggctcagttggtagggacattgcataatatatgcaggggccggagtttgaa-cccggacaccccactt |
36763506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 37740779 - 37740883
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||| |||||||||| ||| |||| | | |||||||| | ||||||||| |||||||| ||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
37740779 |
ctcaattggtagggacattacataatttttgcaggagtcagagttcgaacctcggacacctcacttttccacatttaattgtgtgaactccagccactag |
37740878 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
37740879 |
actac |
37740883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 210
Target Start/End: Original strand, 44106615 - 44106685
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||| | ||| || |||||||| |||||||||||||| |
|
|
| T |
44106615 |
ctcagttgctagggatattgcatattatatgcaggggccgtgattc-aaacccggaca-cccacttctccaca |
44106685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 242
Target Start/End: Complemental strand, 46328985 - 46328907
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| | ||| ||||| | ||||| ||||||||||||||||| |
|
|
| T |
46328985 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcac-cttataag-gtgaattctagccactaggctac |
46328907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 201
Target Start/End: Original strand, 49728702 - 49728774
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||| ||||||||| ||||| |||||||| ||||||||| |||| |
|
|
| T |
49728702 |
tgagcttaactcaattggtagggatattgcattttatatgcaagagccagggttcgaatcccggacactccac |
49728774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 50526693 - 50526586
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||| | |||||||| | |||||| | | ||| |||||||||||||||| ||| |||| ||| |||| ||||||| ||||||||| |
|
|
| T |
50526693 |
ttagctcagttggtaggaacattgcataatttatgcaagggtcgaagttcgaaccccggaca-tccagttcttcacgtttaattgtgtgagctctagcca |
50526595 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||| ||||| |
|
|
| T |
50526594 |
ctaagctac |
50526586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 208
Target Start/End: Complemental strand, 52046452 - 52046372
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| || | || ||||||||||| |||||| ||| ||||||| |
|
|
| T |
52046452 |
gtgagcttagctcagttggtagggatattgcattttatatacaatggtcggggttcgaaccctggacactccatttctcca |
52046372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 236
Target Start/End: Original strand, 2106029 - 2106136
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactct |
228 |
Q |
| |
|
||||| |||||||||| ||| || ||||||||||||||||||| | || |||||||| ||||||| || | |||| ||||||| | |||||||| ||| |
|
|
| T |
2106029 |
gagttaagctcagttgatagagacattgcatattatatgcaggggtcggggttcgaataccggacatcctatttcttcacatttaaaatgtgtgagctcc |
2106128 |
T |
 |
| Q |
229 |
agccacta |
236 |
Q |
| |
|
|||||||| |
|
|
| T |
2106129 |
agccacta |
2106136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 208
Target Start/End: Original strand, 7517945 - 7518020
Alignment:
| Q |
134 |
ttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||| |||||| ||||||||||| | | | ||||||||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
7517945 |
ttagctcatttggtaagggatattgcacaatttgtgcaggagccgcggttcgaaccccgaacaccccacttatcca |
7518020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 230
Target Start/End: Complemental strand, 12894597 - 12894494
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||| || |||| ||||||||| |||| || |||||||||||| ||| | ||||||| || |
|
|
| T |
12894597 |
gtgagcttaactcagttggtagggatattgcattttatatgtagaggccggggttcgaacttcggatacttcacttctccacaattaaattgtgtgagct |
12894498 |
T |
 |
| Q |
227 |
ctag |
230 |
Q |
| |
|
|||| |
|
|
| T |
12894497 |
ctag |
12894494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 241
Target Start/End: Original strand, 23954870 - 23954961
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||||||||||| ||||| ||||| ||| | ||||||| ||||||||||||||||| |
|
|
| T |
23954870 |
gatattgcatattatatgcaggggttgaggttcaaaccccggacattgcacttttccactattaaattgtgtgagctctagccactaggcta |
23954961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 24751323 - 24751280
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
24751323 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
24751280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 242
Target Start/End: Original strand, 32429802 - 32429865
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||| | ||||||| ||||| |||||||||||| |
|
|
| T |
32429802 |
gttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaaccactaggctac |
32429865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 182
Target Start/End: Complemental strand, 51152683 - 51152640
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggtt |
182 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
51152683 |
tcagttggtagggatgttgcatattatatgcaggagtcgaggtt |
51152640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 210
Target Start/End: Original strand, 52575461 - 52575547
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| ||||| ||||||||||||||| | ||||||||| ||||||||||| | || | |||||||||| ||||| |||||||||||| |
|
|
| T |
52575461 |
tccccgtgagcttagctcagttggtacgaatattgcattttatatgcagg-ggcgtgattcgaaccccagacacttcacttctccaca |
52575547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 236
Target Start/End: Original strand, 54012091 - 54012197
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| |||||||| |||| ||||| ||||| |||| |||||||| ||||||||||||||| |||| ||||||||||| |||||| ||||||| ||| |
|
|
| T |
54012091 |
tgagcttagctcaattggcagggacattgcttattttatgcagggaccgaggttcgaaccctagaca-cccacttctccgtatttatttgtgtgagttct |
54012189 |
T |
 |
| Q |
229 |
agccacta |
236 |
Q |
| |
|
||| |||| |
|
|
| T |
54012190 |
agcaacta |
54012197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 8756527 - 8756609
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| ||||||||||||| ||||||||| ||||||||||| | || ||||||||| ||||||| || ||||||||| |
|
|
| T |
8756527 |
gtgagcttaactcagttggtaggaatattgcattttatatgcaggggtcggggttcgaacatcggacacttcaattctccaca |
8756609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 120 - 210
Target Start/End: Original strand, 19151528 - 19151618
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| || ||||||| |||| |||||| |||||| ||||| |||| | || || |||||||||||||||||| ||||||||||||| |
|
|
| T |
19151528 |
ttatccccgtaagtttagttcagcgggtaggaatattgtatattgtatgtggaagtcggggttcgaaccccggacactccacttctccaca |
19151618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 126 - 196
Target Start/End: Complemental strand, 36834774 - 36834704
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||||| ||||||||| || ||||||||||| |||||||||||||| | || ||||| ||| |||||||| |
|
|
| T |
36834774 |
ctgtgagcttagctcagctgatagggatattgtatattatatgcaggggtcggggttcaaactccggacac |
36834704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 166782 - 166863
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| |||||||| |||||| |||||| |||||| | |||||||| |||| |||||||||||| |||||| ||||| |
|
|
| T |
166782 |
tccccgtgagcttagctcacttggtaagggataatgcataatttatgcaggggccggggttcgaaccccagacacctcactt |
166863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 10959139 - 10959208
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| ||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
10959139 |
tagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccactt |
10959208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 241
Target Start/End: Original strand, 15492107 - 15492208
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggc |
239 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| || | | || ||| | |||||| |||||| |||||| ||| | ||||||| ||||||||||||||| |
|
|
| T |
15492107 |
agttggtagggatattgcattttatatgaaggggctgggatttaaacactggacactccacttttccacaattaaattgtgtgagctctagccactaggc |
15492206 |
T |
 |
| Q |
240 |
ta |
241 |
Q |
| |
|
|| |
|
|
| T |
15492207 |
ta |
15492208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 24537861 - 24537902
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
24537861 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
24537902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 172
Target Start/End: Original strand, 26259131 - 26259176
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
26259131 |
tgtgaatttagctcaattggtagggatatcgcatattatatgcagg |
26259176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 36331815 - 36331746
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| |||| ||||| | ||||| |||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
36331815 |
tagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccactt |
36331746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 242
Target Start/End: Original strand, 40212388 - 40212488
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||||||||||||| || ||||||||||| | | ||||||||||||| | | | |||||||||| ||||| ||||||| |||||| ||||| ||| |
|
|
| T |
40212388 |
agttggtagggatattg-atgttatatgcaggggttggggttcgaaccccgtatatctcacttctccatatttaattgtgtgatctctagtcactaagct |
40212486 |
T |
 |
| Q |
241 |
ac |
242 |
Q |
| |
|
|| |
|
|
| T |
40212487 |
ac |
40212488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 43774179 - 43774260
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||| |||||||||||| ||||| | ||||| ||||||||||| | || |||||||||||| |||||||||||| |
|
|
| T |
43774179 |
tccccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcgaaccccagacaccccactt |
43774260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 49146084 - 49146190
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||| | | ||||| |||||||||||| | || ||||||||||||||||||||||||| | ||| |||||| | ||||| | |
|
|
| T |
49146084 |
gtgagcttaactcagttggtagg-acaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac-tttataag-gtgaatt |
49146180 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
49146181 |
ctagccacta |
49146190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 242
Target Start/End: Original strand, 51233623 - 51233684
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| | |||||||||||||| | ||||| | |||||||||||||||||| |
|
|
| T |
51233623 |
ttcgaaccccggacatctcacttctccacattaaaatgtgcgggctctagccactaggctac |
51233684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 212
Target Start/End: Complemental strand, 53986555 - 53986522
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
53986555 |
ggttcgaaccccggacaccccacttctccacatt |
53986522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 126 - 201
Target Start/End: Original strand, 3784067 - 3784143
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||| |||||||||||| ||||| | ||||| ||||||| |||| | || ||||||||||||||||||||||| |
|
|
| T |
3784067 |
ctgtgagcatagctcagttggcagggacaatgcattattatatacaggggtcggggttcgaaccccggacaccccac |
3784143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #275
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 242
Target Start/End: Original strand, 9114049 - 9114129
Alignment:
| Q |
163 |
tatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| | |||| |||||| || |||||||||||||||||||||| | |||||||| ||| || ||||||||||| |
|
|
| T |
9114049 |
tatatgcaggggtcgagattcgaattccagacaccccacttctccacatttaaaatgtgtgagctccagtcactaggctac |
9114129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #276
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 9274745 - 9274681
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccc |
198 |
Q |
| |
|
|||||||||||| || || |||||||| |||||||||||||||||| ||||||| || |||||| |
|
|
| T |
9274745 |
ttagctcagttgataaagacattgcataatatatgcaggagccgaggatcgaacctcgaacaccc |
9274681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #277
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 203
Target Start/End: Complemental strand, 21420284 - 21420209
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||||||||| | | ||||| ||||||||||| | ||||||||||| || ||||||||||||| |
|
|
| T |
21420284 |
gtgagtttagctcagttggtagg-acaatgcattattatatgcagcggtcgaggttcgaatcctggacaccccactt |
21420209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #278
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 23327796 - 23327884
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccc-cacttctccacattta |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||| |||||| || || ||||||| |||||||||| ||||| |
|
|
| T |
23327796 |
tgtgagtttagctcagttggtaaaaatattgcatattatatgcaagagataaggttcaaagcctagacaccctcacttctccatattta |
23327884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #279
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 36741172 - 36741260
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| |||| ||||||| ||| |||||| |||| ||||||||||||| ||||||| |||| | || | | ||||||||||||||| |
|
|
| T |
36741172 |
ctgtgagattagttcagttgatagagatattacataatatatgcaggagctgaggttcaaacctcagatattctacttctccacattta |
36741260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #280
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 46817367 - 46817323
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
46817367 |
ggtttgaaccccgaacaccccacttctccacatttaaatgtgtga |
46817323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #281
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 167
Target Start/End: Complemental strand, 47640076 - 47640036
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
47640076 |
tgtgagtttatctcatttggtagggatattgcatattatat |
47640036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #282
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 223
Target Start/End: Original strand, 49284821 - 49284920
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||||||| |||| |||| |||| ||||||||| | |||||||| | | |||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
49284821 |
tccccgtgagtttatctcaattggcaggg-tattgcataatttatgcagggacgggagttcgaaccctggaaaccccacttctccacatttaattgtgtg |
49284919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #283
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 194
Target Start/End: Original strand, 51467185 - 51467245
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggac |
194 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||| | | |||||||||||||||| |
|
|
| T |
51467185 |
ttagctcagttgatagggatatcgcattttatatgcaggggttggggttcgaaccccggac |
51467245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #284
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 170
Target Start/End: Original strand, 552173 - 552216
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
552173 |
tgtgagcttaactcagttggtagggatattgcataatatatgca |
552216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #285
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 203
Target Start/End: Complemental strand, 7448466 - 7448383
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| ||||| ||||||||||| |||||| | ||||| |||||||||||| |||| | |||||||||| || ||||||||| |
|
|
| T |
7448466 |
tatccccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccactt |
7448383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #286
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 203
Target Start/End: Complemental strand, 7456608 - 7456525
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| ||||| ||||||||||| |||||| | ||||| |||||||||||| |||| | |||||||||| || ||||||||| |
|
|
| T |
7456608 |
tatccccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccactt |
7456525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #287
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 214
Target Start/End: Complemental strand, 16675319 - 16675253
Alignment:
| Q |
148 |
agggatattgcatatt-atatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||||||||| ||||||| | |||| |||||||||||||||| ||||||||||||| |||| |
|
|
| T |
16675319 |
agggatattgcatatttatatgcaagggccggagttcgaaccccggaca-cccacttctccacgttta |
16675253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #288
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 31698565 - 31698608
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
31698565 |
tattatatgcaggagccggggttcgaacctcgaacaccccactt |
31698608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #289
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 195
Target Start/End: Complemental strand, 35126330 - 35126263
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||| |||||||| || | | ||||| || |||||||| |
|
|
| T |
35126330 |
gtgagtttaactcagttggtagggataatgcataatatatgcaagatctggggttcaaatcccggaca |
35126263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #290
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 35200557 - 35200644
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||| ||||||| || | || ||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
35200557 |
gtgagcttagctcagttggtagggacaaatgcattttatatgtagaggtcggggttcaaaccccggacacctcatttctccacattta |
35200644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #291
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 172
Target Start/End: Original strand, 37112814 - 37112857
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
37112814 |
tgagcttagctcagttggtaaggatattgcattttatatgcagg |
37112857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #292
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 204
Target Start/End: Original strand, 44827137 - 44827188
Alignment:
| Q |
153 |
tattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttc |
204 |
Q |
| |
|
|||||||||||| ||||||| |||| ||| |||||||||||||| ||||||| |
|
|
| T |
44827137 |
tattgcatattaaatgcaggggccggggtacgaaccccggacactccacttc |
44827188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #293
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 45431627 - 45431702
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| ||| |||| |||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
45431627 |
tgagcttagctcacttggtaagggataatgcgtattttatgcaggggtcagggttcgaaccccggacaccccactt |
45431702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #294
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 231
Target Start/End: Original strand, 49577388 - 49577475
Alignment:
| Q |
144 |
tggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagc |
231 |
Q |
| |
|
||||||||| |||||||| | ||||||| | || |||| |||||| ||||||||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
49577388 |
tggtagggacattgcataatttatgcagcggtcggggtttaaaccccagacaccccacttctccatatttaattgtgtgagctctagc |
49577475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #295
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 52030153 - 52030196
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||| |||| |
|
|
| T |
52030153 |
tattatatgcaggggccggggttcgaaccccggacaccctactt |
52030196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #296
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 201
Target Start/End: Original strand, 6447032 - 6447106
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||| |||||| | ||||||||||| |||||| ||||||| | | |||||||||||||||||| |||| |
|
|
| T |
6447032 |
tgtgagtttgactcagtagctagggatattgtatattacatgcaggggtcagggttcgaaccccggacactccac |
6447106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #297
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 242
Target Start/End: Complemental strand, 9326504 - 9326414
Alignment:
| Q |
152 |
atattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||| ||||||| ||| || | |||||||| |||||||| ||||| ||||| ||||| |
|
|
| T |
9326504 |
atattgcatattatatgcagaggacggggttcgaacgtcggacactccattttttcacatttaaatgtgtgagctctaatcactaagctac |
9326414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #298
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 200
Target Start/End: Complemental strand, 16874251 - 16874213
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
16874251 |
ttatatgcaggggccgaggttcgaaccgcggacacccca |
16874213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #299
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 19137653 - 19137691
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
19137653 |
ttatatgcaggggccgaggttcgaaccccagacacccca |
19137691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #300
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 209
Target Start/End: Original strand, 20707236 - 20707317
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| |||| | ||||||| ||||||||| |||||||||||| |
|
|
| T |
20707236 |
tgtgagtttagctcagttggtatagatattgtatattatatacagggtttggtgttcgaa-cccggacactccacttctccac |
20707317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #301
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 191
Target Start/End: Original strand, 21405159 - 21405229
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
191 |
Q |
| |
|
|||||| ||||| ||| ||||||||| ||||||||||||| | ||||| |||||| | |||||||| |||| |
|
|
| T |
21405159 |
tatccccgtgagcttacctcagttggaagggatattgcatttaatatgtaggagctggggttcgaatcccg |
21405229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #302
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 206
Target Start/End: Original strand, 25488888 - 25488965
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||| ||| |||||||| |||||||||| ||||||||||| ||| |||||||||||||| || |||||||||||| |
|
|
| T |
25488888 |
gtgagcttaactcagttgttagggatattacatattatatgtagggatcgaggttcgaaccctgg-taccccacttctc |
25488965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #303
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 242
Target Start/End: Complemental strand, 25716055 - 25716005
Alignment:
| Q |
192 |
gacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
25716055 |
gacactccacttctccacatttaattgtttgagctctagccactaggctac |
25716005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #304
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 29531226 - 29531331
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggac-accccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||||||| | | |||||||| | |||| ||| | || |||||| ||||||||| ||| |||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
29531226 |
gctcagttggtatgaacattgcataatttatgaaggggtcggggttcg-accccggacaacctcacttctccacatttaattgtgtgagctctaaccact |
29531324 |
T |
 |
| Q |
236 |
aggctac |
242 |
Q |
| |
|
|| |||| |
|
|
| T |
29531325 |
agactac |
29531331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #305
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 162
Target Start/End: Original strand, 34757532 - 34757566
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatat |
162 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34757532 |
gtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #306
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 242
Target Start/End: Complemental strand, 36478214 - 36478140
Alignment:
| Q |
169 |
caggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||| |||||||||| |||||| | |||||||||||||| | |||||||| ||| |||||||||||||| |
|
|
| T |
36478214 |
caggggccggggttcgaacctcggacatctcacttctccacattaaaaatgtgtgagctccagccactaggctac |
36478140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #307
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Complemental strand, 37921059 - 37921017
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
37921059 |
gtgagtttagctcagttgatagggataatgcataatatatgca |
37921017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #308
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 202
Target Start/End: Original strand, 55426114 - 55426188
Alignment:
| Q |
129 |
tgagtttagctcagttggtag-ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
|||| |||||||| |||||| ||||| |||| | ||| |||| | ||||||||||||||||||||||||||||| |
|
|
| T |
55426114 |
tgagcttagctcatttggtaaaggataatgcacaatatgtgcatgggccgaggttcgaaccccggacaccccact |
55426188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #309
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 197
Target Start/End: Complemental strand, 8113623 - 8113554
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
||||| ||||||||||||||| ||| | |||||| |||||||| || ||| |||||||| ||||| |||| |
|
|
| T |
8113623 |
gtgagcttagctcagttggtaaggacaatgcataatatatgcaagatccgcggttcgaatcccggccacc |
8113554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #310
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 11668330 - 11668289
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
11668330 |
ttatatgcagaagccggggttcgaaccacggacaccccactt |
11668289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #311
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 236
Target Start/End: Complemental strand, 23164191 - 23164111
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||||||||| | | || ||||||| ||||| ||||||||||||| ||| | ||||||| |||||||||||| |
|
|
| T |
23164191 |
tgcatattatatgcaggagttgggatttgaacccc-gacactccacttctccacaattaaattgtgtgagctctagccacta |
23164111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #312
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 168
Target Start/End: Original strand, 25363575 - 25363616
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
25363575 |
tgtgagtttaactcagtttgtaaggatattgcatattatatg |
25363616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #313
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 168
Target Start/End: Complemental strand, 26593275 - 26593226
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| | ||||| ||||||||||| |
|
|
| T |
26593275 |
tttatccccgtgagtttaactcagttggtatgaatattacatattatatg |
26593226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #314
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 27394502 - 27394582
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| | |||||| |||||| |||||| ||||| ||||||||||| || | |||| |||||||||||||||||||| |
|
|
| T |
27394502 |
tccccgtgagctaagctcacttggtaagggataatgcat-ttatatgcaggggctggggtttgaaccccggacaccccactt |
27394582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #315
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 34579517 - 34579410
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||| ||||||||||| || ||||||| ||| |||||||||| | |||| ||||||||||||| ||| || ||||||||| |
|
|
| T |
34579517 |
gtgagcttaactcagttgatagggatattgaattttatatgtagg-------gttcgaaccctg-acactccacttctccacaattaaattgtgtgaact |
34579426 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
34579425 |
ctagccactagactac |
34579410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #316
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 170
Target Start/End: Original strand, 36431810 - 36431851
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
|||||||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
36431810 |
tgagtttagctcagttggtagggataatgtataatatatgca |
36431851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #317
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 168
Target Start/End: Complemental strand, 42831988 - 42831951
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
42831988 |
agtttagctcacttggtagggataatgcatattatatg |
42831951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #318
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 47191379 - 47191448
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| || | |||||||||||| ||||||||||| |
|
|
| T |
47191379 |
tagctcagttggcagggacaatgcattattatatgcaggggctggagttcgaaccccgaacaccccactt |
47191448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #319
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 49639035 - 49639103
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||| ||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
49639035 |
tagctcagttggtagg-acaatgcattattatatgtaggggccggggttcgaaccccgaacaccccactt |
49639103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #320
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 203
Target Start/End: Complemental strand, 13540059 - 13539984
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| |||||||||||||||| | | ||||| |||||||| ||| | | ||||||||||||||||||||||||| |
|
|
| T |
13540059 |
gtgagtatagctcagttggtagg-acaatgcattattatatgtaggggttggggttcgaaccccggacaccccactt |
13539984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #321
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 197
Target Start/End: Complemental strand, 14271993 - 14271953
Alignment:
| Q |
157 |
gcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
14271993 |
gcatattatatgcaggggccggagttcgaaccccggacacc |
14271953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #322
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 19866477 - 19866589
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||| | |||||||||||||| ||||||| ||| | | ||||| |||||| |||| | ||||||||||| ||| | ||||||| || |
|
|
| T |
19866477 |
gtgagcttagctcagt-gatagggatattgcattttatatgtaggggttggggttcaaaccccagaca--caacttctccacaattaaattgtgtgagct |
19866573 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
19866574 |
ctagccacttggctac |
19866589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #323
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 206
Target Start/End: Complemental strand, 24312329 - 24312269
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||||||||| ||| ||||||| ||| | |||||||||||| ||||||| ||||||||| |
|
|
| T |
24312329 |
gtagggatattacattttatatgtaggggttgaggttcgaacctcggacactccacttctc |
24312269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #324
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 199
Target Start/End: Original strand, 25165431 - 25165511
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacacccc |
199 |
Q |
| |
|
||||||| |||| |||||||| |||||| |||||| |||| | ||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
25165431 |
ttatccccatgagcttagctcatttggtaagggataatgcacaatatgtgcagggaccggggttcgaaccccggacacccc |
25165511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #325
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 29645883 - 29645847
Alignment:
| Q |
167 |
tgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
29645883 |
tgcaggggccggggttcgaaccccggacaccccactt |
29645847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #326
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 216
Target Start/End: Complemental strand, 30250224 - 30250188
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
30250224 |
gttcgaactccggacaccccacttctccatatttata |
30250188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #327
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 34757570 - 34757634
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccaca-tttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| | ||||| |||||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
34757570 |
ggttcgaaccacagacacttcacttctccacaatttaattgtgtgagctctagccactaggctac |
34757634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #328
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 205
Target Start/End: Complemental strand, 37097129 - 37097046
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
||||||||| || ||| |||||||| |||| ||||||||| ||| |||||||| ||| |||||||| |||| ||| |||||||| |
|
|
| T |
37097129 |
tatccctgtaagcttaactcagttgatagg-atattgcattttacatgcaggaaccggagttcgaactccggtcactccacttct |
37097046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #329
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 242
Target Start/End: Original strand, 40160769 - 40160849
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| || || | |||| |||||||||||||||||||| | ||| |||| | ||||| ||||||||||||||||| |
|
|
| T |
40160769 |
ttatatgccggggctggggtttgaaccccggacaccccacttattcacctttaaaaaggtgaattctagccactaggctac |
40160849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #330
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 188
Target Start/End: Complemental strand, 44945728 - 44945668
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
188 |
Q |
| |
|
||||| ||| ||||||||||||| ||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
44945728 |
gtgagcttatctcagttggtaggaatattgcgtattatatgcagaggccggagttcgaacc |
44945668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #331
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 46754558 - 46754642
Alignment:
| Q |
155 |
ttgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||| | ||||||||| ||| | ||||||| |||||| ||||||| |
|
|
| T |
46754558 |
ttgcatattatatgcaggggtcggatttcgaaccccggacaccttatttctccacagttaaattgtgtgagctctagtcactagg |
46754642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 305)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 22274677 - 22274564
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||| |||| |
|
|
| T |
22274677 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacaccccacttctccacaattaattgtgtgagctct |
22274578 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22274577 |
agccactaggctac |
22274564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 10083166 - 10083275
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
10083166 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggggtcgaggttcgaaccccggacaccccacttctccatatttatatgtgtgagctc |
10083265 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
10083266 |
tagccactag |
10083275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 10736947 - 10736826
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
10736848 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
10736847 |
tgagctctagccactaggctac |
10736826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 31712545 - 31712666
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31712545 |
tatccccgtgagtttagctcacttggcagggatattgtatattatatgtaggggccagggttcgaaccccggacaccccacttctccacatttatatgtg |
31712644 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
31712645 |
tgagctctagccactaggctac |
31712666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 2787148 - 2787033
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
2787148 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
2787049 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2787048 |
ctagccactaggctac |
2787033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 17698518 - 17698640
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
17698518 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgt |
17698617 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
17698618 |
gtgagctctagccactaggctac |
17698640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 5328640 - 5328519
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||| ||| | ||||| |
|
|
| T |
5328640 |
atccctgtaagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaaatgtg |
5328541 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
5328540 |
tgagctctagccactaggctac |
5328519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 28909462 - 28909583
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
28909561 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
28909562 |
tgagctctagccactaggctac |
28909583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 34413059 - 34413180
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
34413158 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
34413159 |
tgagctctaaccactaggctac |
34413180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 34894378 - 34894487
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
34894378 |
ttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacagttaaattgtgtgagctctagcc |
34894477 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
34894478 |
actaggctac |
34894487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 37717360 - 37717481
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
37717459 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
37717460 |
tgagctctagccactaggctac |
37717481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 38620414 - 38620293
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||| |||| ||||||||||||| ||| | |||| |
|
|
| T |
38620414 |
atccctgtgagcttagctcagttggtagggatattgtatattatatgcaggagccgggattcgaaccccgaacactccacttctccacaattaaattgtg |
38620315 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38620314 |
tgaactctagccactaggctac |
38620293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 43284039 - 43283918
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||| ||| | |||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtg |
43283940 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
43283939 |
tgagctctagccactagactac |
43283918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 43186856 - 43186971
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
43186856 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccaggattcgaaccccggacactccacttctccacaattaaattgtgtgagct |
43186955 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43186956 |
ctagccactaggctac |
43186971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 94585 - 94463
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
94585 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggacactccacttctccacaattaaattgt |
94486 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| |||||||||||| |
|
|
| T |
94485 |
gtgagctctaaccactaggctac |
94463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 6659285 - 6659407
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
6659285 |
tatccccgtgagattagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
6659384 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| || |||||| |||||||| |
|
|
| T |
6659385 |
gtgagctttagccagtaggctac |
6659407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 6739687 - 6739809
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
6739687 |
tatccccgtgagattagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
6739786 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| || |||||| |||||||| |
|
|
| T |
6739787 |
gtgagctttagccagtaggctac |
6739809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 17027954 - 17027833
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||| ||| | ||| |
|
|
| T |
17027954 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaa-cccggacaccccacttctccacaattaaattgt |
17027856 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
17027855 |
gtgagctctagccactaggctac |
17027833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 17558390 - 17558269
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||| ||| | ||| |
|
|
| T |
17558390 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaa-cccggacaccccacttctccacaattaaattgt |
17558292 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
17558291 |
gtgagctctagccactaggctac |
17558269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 6280477 - 6280598
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
6280477 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccacttctccacagtttaattgtg |
6280576 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||| ||||||||||||| |
|
|
| T |
6280577 |
tgagctctggccactaggctac |
6280598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 11875883 - 11876004
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtg |
11875982 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
11875983 |
tgagctctaaccactaggctac |
11876004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 11890890 - 11891011
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtg |
11890989 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
11890990 |
tgagctctaaccactaggctac |
11891011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 29716857 - 29716978
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
29716956 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||| ||||||| |
|
|
| T |
29716957 |
tgagctctaaccacgaggctac |
29716978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 38219641 - 38219520
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtg |
38219542 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
38219541 |
tgagctctagccactaggctac |
38219520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 23178963 - 23178843
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgt |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||| ||| ||||| ||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttcttcacaatttaattgtgt |
23178864 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
23178863 |
gagctctagccactaggctac |
23178843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 29514620 - 29514744
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||| | ||||| |||||||||||| ||||||||||||| ||| | | |
|
|
| T |
29514620 |
tttatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggagctggggttcaaaccccggacactccacttctccacaattaaatt |
29514719 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
29514720 |
gtgtgagctctagccactaggctac |
29514744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 31451024 - 31450909
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
31451024 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaattgtgtgagct |
31450925 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31450924 |
ctagccactaggctac |
31450909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 257535 - 257657
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
257535 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgt |
257634 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
257635 |
gtgagctctagccactaggctac |
257657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 658385 - 658263
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
658385 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgt |
658286 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
658285 |
gtgagctctagccactaggctac |
658263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 844121 - 843999
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
844121 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccacaattaaattgt |
844022 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
844021 |
gtgagctctagccactaggctac |
843999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 1937306 - 1937428
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||| ||| ||| | ||| |
|
|
| T |
1937306 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctctacaattaaattgt |
1937405 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
1937406 |
gtgagctctagccactaggctac |
1937428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 8265264 - 8265386
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||| |||||||||||| ||||| ||| |
|
|
| T |
8265264 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaaccccggacactccacttctccacaatttaattgt |
8265363 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
8265364 |
gtgagctctagccactaggctac |
8265386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 10568081 - 10568203
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||| | | |||| ||||||||||||||||||||||||||| ||| | ||| |
|
|
| T |
10568081 |
tatccccgtgagtttagctcagttggtagggatattgcatattaaatgcaggggaaggggtttgaaccccggacaccccacttctccacaattaaattgt |
10568180 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
10568181 |
gtgagctctagccactaggctac |
10568203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 26192783 - 26192669
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||| ||| | |||||||||||| |
|
|
| T |
26192783 |
gtgagcttagttcagttggtagggatattgcatattatatgcagaggtcggggttcgaaccccggacaccccacttctccatattaaaatgtgtgaactc |
26192684 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
26192683 |
tagccactagactac |
26192669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 3912237 - 3912116
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtg |
220 |
Q |
| |
|
||||| ||||||||| ||| ||||||||| |||||||||||||||||||| ||||||||| ||| || ||||||||||||||||||||||||| ||||| |
|
|
| T |
3912237 |
atccccgtgagtttaactcggttggtaggaatattgcatattatatgcagaggccgaggtttgaatcctggacaccccacttctccacatttataatgtg |
3912138 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
3912137 |
tgagctctagccactaggctac |
3912116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 7816412 - 7816521
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
7816412 |
ttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaacctcggacactccacttctccacaattaaattgtgtgagctctagcc |
7816511 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
7816512 |
actaggctac |
7816521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 17072636 - 17072515
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||| ||| | |||| |
|
|
| T |
17072636 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccacttctccacaattaaattgtg |
17072537 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
17072536 |
tgagctctagccactaggctac |
17072515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 17575635 - 17575756
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||| ||| | |||| |
|
|
| T |
17575635 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccacttctccacaattaaattgtg |
17575734 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
17575735 |
tgagctctagccactaggctac |
17575756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 26022244 - 26022365
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
26022244 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccacaatttaattgtg |
26022343 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
26022344 |
tgacctctagccactagactac |
26022365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 481009 - 481128
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
481009 |
tccccgtgagcttagctcagttggtagggacattgcataatttatgcaggggccgcggttcgaaccccggacaccccacttctccacatttaattgtgtg |
481108 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| | ||||||||||||||| |
|
|
| T |
481109 |
agatttagccactaggctac |
481128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 8034487 - 8034364
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||||||||||||||||| |||| ||||||||| || ||||||||||||||||||| ||| | || |
|
|
| T |
8034487 |
ttatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaacaccagacaccccacttctccacaattaaattg |
8034388 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
8034387 |
tgtgagttctagccactaggctac |
8034364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 10200748 - 10200633
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| | ||| | ||||||| || |
|
|
| T |
10200748 |
gtgagcttagctcagttggtagagatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtgtgagct |
10200649 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10200648 |
atagccactaggctac |
10200633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 28420491 - 28420376
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||| ||| | ||||||| || |
|
|
| T |
28420491 |
gtgagcttagctcagttggtaggaatattgcatattatatgctggagccggggttcgaaccccggacactccacttctccacgattaaattgtgtgagct |
28420392 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28420391 |
ctagccactaggctac |
28420376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 133 - 242
Target Start/End: Complemental strand, 13647519 - 13647409
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagc |
231 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
13647519 |
tttagctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagc |
13647420 |
T |
 |
| Q |
232 |
cactaggctac |
242 |
Q |
| |
|
|||||| |||| |
|
|
| T |
13647419 |
cactagactac |
13647409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 133 - 242
Target Start/End: Complemental strand, 13747944 - 13747834
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagc |
231 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
13747944 |
tttagctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagc |
13747845 |
T |
 |
| Q |
232 |
cactaggctac |
242 |
Q |
| |
|
|||||| |||| |
|
|
| T |
13747844 |
cactagactac |
13747834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 24458312 - 24458434
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgt |
219 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||||||||| |||||||||||||| |||| ||||||||||||||| || | ||||||||||||||| ||| |
|
|
| T |
24458312 |
ttatccccgtgagcttagctcagttggaagggatattgtatattatatgcaggggccggggttcgaaccccggatactcaacttctccacatttaattgt |
24458411 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||| |||| |
|
|
| T |
24458412 |
gtgagctctagccactagactac |
24458434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 34266008 - 34266130
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||| ||||||||||||| ||| | ||| |
|
|
| T |
34266008 |
tatccccgcgagcttagctcagttggtagggatattgcatattatatgcaggagttggggttcgaacctcggacactccacttctccacaattaaattgt |
34266107 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
34266108 |
gtgagctctagccactaggctac |
34266130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 7797139 - 7797248
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| ||| || ||||| |
|
|
| T |
7797139 |
ttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtatgagctatagcc |
7797238 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
7797239 |
actaggctac |
7797248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 10030409 - 10030530
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||| | |||| |||||||||||| | ||| |||| |
|
|
| T |
10030409 |
atccctgtgagtttagctcagttggtagagatattgcatattatatgcaggtgccggggttcgaaccctgaacactccacttctccacaagttaactgtg |
10030508 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
10030509 |
tgagttctagccactaggctac |
10030530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 14876675 - 14876554
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||| |||||||||||| || || |||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatattatatgcaggagccggggttcgaacctcggacactccacttctccacaatataattgtg |
14876576 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
14876575 |
tgagctctaaccactaggctac |
14876554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 16432189 - 16432080
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
16432189 |
ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacatcggacactccacttctccataatttaattgtgtgagctctagcc |
16432090 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
16432089 |
actaggctac |
16432080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 16449122 - 16449243
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccagacactccacttctccacaatttaattgtg |
16449221 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
16449222 |
tgagctctagccactaggctac |
16449243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 23435306 - 23435185
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgtg |
220 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| |||| |||| |
|
|
| T |
23435306 |
atccctgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccacagtttaattgtg |
23435207 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||| |||| || ||||| |
|
|
| T |
23435206 |
tgagctctggccaataagctac |
23435185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 13406594 - 13406718
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||| | ||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||| ||| | | |
|
|
| T |
13406594 |
tttatctccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggagttcgaaccctggacactccacttctccacaattaaatt |
13406693 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||| ||||| |
|
|
| T |
13406694 |
gtgtgagctctagccactatgctac |
13406718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 122 - 233
Target Start/End: Original strand, 42880945 - 42881057
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
42880945 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
42881044 |
T |
 |
| Q |
221 |
tgaactctagcca |
233 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
42881045 |
tgagctctagcca |
42881057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 27077172 - 27077049
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||| | || |||||||| ||||||||||||||||||||||| ||| | || |
|
|
| T |
27077172 |
ttatctctgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccggacaccccacttctccacaattaaattg |
27077073 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||| | ||| |||||||| |
|
|
| T |
27077072 |
tgtgagctcgaaccattaggctac |
27077049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 34158724 - 34158609
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| | || ||||||||||||| ||| | ||||||| || |
|
|
| T |
34158724 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcatactccacttctccacaattaaattgtgtgagct |
34158625 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
34158624 |
ctagctactaggctac |
34158609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 37290925 - 37291040
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| || ||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
37290925 |
gtgagcttaacttagttgatagggatattgcatattatatgcaggggccggcgttcgaaccccggacaccccacttctccacaattaaattgtgtgagct |
37291024 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37291025 |
ctagccactaggctac |
37291040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 38344052 - 38344167
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
38344052 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
38344151 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
38344152 |
ctagccactagactac |
38344167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 119 - 241
Target Start/End: Original strand, 42006772 - 42006895
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatat |
217 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | | || |||||||||||| ||||| | |
|
|
| T |
42006772 |
tttatctctgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgtggttcgaaccctgaatactccacttctccacaatttaatt |
42006871 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||| | |||||||||||||| |
|
|
| T |
42006872 |
gtgtgagttttagccactaggcta |
42006895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 120 - 237
Target Start/End: Complemental strand, 37535574 - 37535456
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||| || | |||||||||||||||||| ||| |||||||| ||||| || |
|
|
| T |
37535574 |
ttatctctgtgagtttagctcaattggtagggatattgcatattatatgcagaagtcagggttcgaaccccggacactccatttctccacaatttaattg |
37535475 |
T |
 |
| Q |
219 |
tgtgaactctagccactag |
237 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
37535474 |
tgtgaactctaaccactag |
37535456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 38283127 - 38283241
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| ||||||||| ||||| ||| ||| | |||||||| |||| |||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38283127 |
gtgagtttaactcagttggcagggacattatataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaattgtgtgaactc |
38283226 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38283227 |
tagccactaggctac |
38283241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 2792776 - 2792897
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtg |
2792875 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| | ||||||| |||| |
|
|
| T |
2792876 |
tgagctccaaccactagactac |
2792897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 129 - 210
Target Start/End: Original strand, 7194266 - 7194347
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccaca |
7194347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 129 - 234
Target Start/End: Original strand, 12770372 - 12770477
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| |||||||||||| |||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
12770372 |
tgagcttagctcagttgatagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtgagctct |
12770471 |
T |
 |
| Q |
229 |
agccac |
234 |
Q |
| |
|
|||||| |
|
|
| T |
12770472 |
agccac |
12770477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 29734078 - 29733957
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||||||| ||||||||||| |||||||| |||||||||||||||| || ||||||||||||||| || ||||||||| ||| ||| | |||| |
|
|
| T |
29734078 |
atccccgtgagtttaactcagttggtaaggatattgtatattatatgcaggagtcggggttcgaaccccggatactccacttctctacaattaaattgtg |
29733979 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
29733978 |
tgagctctagccactaggctac |
29733957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 150 - 241
Target Start/End: Complemental strand, 1337160 - 1337068
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| ||||||||||||||||| |
|
|
| T |
1337160 |
ggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggcta |
1337068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 110 - 242
Target Start/End: Complemental strand, 2908176 - 2908044
Alignment:
| Q |
110 |
ctatttgaatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
||||||| ||| ||||| |||| |||||| |||| ||||||| | |||||| |||||||||| |||| ||||||||||| ||||||||||||||||| | |
|
|
| T |
2908176 |
ctatttggctttgtccctatgagcttagcttagttagtagggacaatgcataatatatgcaggggccggggttcgaaccctggacaccccacttctccgc |
2908077 |
T |
 |
| Q |
210 |
atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||| | |||||||| |||||||||||||||||| |
|
|
| T |
2908076 |
attaaaatgtgtgagctctagccactaggctac |
2908044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 5332918 - 5333034
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||| |||||||||||||||| |||||| |||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||||||| | |
|
|
| T |
5332918 |
tgtgagcttagctcagttggtagagatattatatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagc |
5333017 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
5333018 |
tctagccactagactac |
5333034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 5683763 - 5683871
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||| | | |||||||||||| ||||||| |||||||||||||||||||||||| |||||| || |
|
|
| T |
5683763 |
ttagctcaattggtaggaatattgcatattatatgcaggggttggggttcgaaccccagacaccctacttctccacatttatatgtgtgagctctagtca |
5683862 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||| ||||| |
|
|
| T |
5683863 |
ctaagctac |
5683871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 122 - 229
Target Start/End: Original strand, 7453349 - 7453457
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||| ||||||| ||| |||| |||||||||||||||||||||||||||||| | ||| | |||| |
|
|
| T |
7453349 |
atccccgtgagtttagctcagctggtagggatattgcattttatatgtaggggccggggttcgaaccccggacaccccacttctccataattaaattgtg |
7453448 |
T |
 |
| Q |
221 |
tgaactcta |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
7453449 |
tgaactcta |
7453457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 119 - 230
Target Start/End: Complemental strand, 30972893 - 30972782
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||| ||||||||||||| ||| | | |
|
|
| T |
30972893 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagccg-ggttcgaatcccggacactccacttctccacaattaaatt |
30972795 |
T |
 |
| Q |
218 |
gtgtgaactctag |
230 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
30972794 |
gtgtgagctctag |
30972782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 140 - 242
Target Start/End: Original strand, 5038573 - 5038676
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||| |||||| ||||||||||||| ||| | ||||||| ||| |||||||||| |
|
|
| T |
5038573 |
cagttggtagggatattgcatattatatgcaggagctggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctccagccactagg |
5038672 |
T |
 |
| Q |
239 |
ctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
5038673 |
ctac |
5038676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 23858200 - 23858315
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||| ||| |||||||| ||||| ||||||| | |
|
|
| T |
23858200 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggccggagttcgaaccctggacactccaattctccacaatttaattgtgtgagtt |
23858299 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23858300 |
ctagccactaggctac |
23858315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 25890472 - 25890357
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||| |||||| |||||||||||| |||||||| | |||||| | |||| |||||||||||||||||||||||||||||||| ||| ||| |||||| |
|
|
| T |
25890472 |
tgtgagcttagcttagttggtagggacattgcataatttatgcaagggccggggttcgaaccccggacaccccacttctccacaattaattgtttgaact |
25890373 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
25890372 |
ctagccattaggctac |
25890357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 26567323 - 26567200
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||| |||||||||||||||||||||||||||| || | |||||||||||||||| | | ||||||||| ||| | || |
|
|
| T |
26567323 |
ttatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggagtcgggattcgaaccccggacactcaatttctccacaattaaattg |
26567224 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
|| || |||||||||||||||||| |
|
|
| T |
26567223 |
tgcgagctctagccactaggctac |
26567200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 33838327 - 33838442
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| || ||||| ||||||||| || ||||| ||| ||||||||| ||| | ||||||| || |
|
|
| T |
33838327 |
gtgagtttagctcagttggtagggatattgcaaattatatgtagaagccggggttcgaactccagacactccatttctccacaattaaattgtgtgagct |
33838426 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33838427 |
ctagccactaggctac |
33838442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 138 - 237
Target Start/End: Original strand, 44444557 - 44444656
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||| ||| ||||||| | |||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacaccccacttctccacaattaattgtgtgagttttagccactag |
44444656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 1503905 - 1504026
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgt |
219 |
Q |
| |
|
||||||| |||| ||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||| |||| ||| ||| |
|
|
| T |
1503905 |
ttatccccatgagcttagctcagttggcagggatattg-atattatatgcaggagccggggttcgaaccccagacaccccacttcttcacaattaattgt |
1504003 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
| |||||||| ||| |||||||| |
|
|
| T |
1504004 |
gcgaactctaaccagtaggctac |
1504026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 121 - 238
Target Start/End: Complemental strand, 1632514 - 1632396
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||| ||||||| ||||||||||||||||| ||||| ||||||||||||||||| || |||||||||||||||||| | ||||||||||| ||| | ||| |
|
|
| T |
1632514 |
tatcactgtgagcttagctcagttggtaggaatattacatattatatgcaggagtcggggttcgaaccccggacactctacttctccacaattaaattgt |
1632415 |
T |
 |
| Q |
220 |
gtgaactctagccactagg |
238 |
Q |
| |
|
|||| ||||| |||||||| |
|
|
| T |
1632414 |
gtgagctctaaccactagg |
1632396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 5570887 - 5571012
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||||||||| ||||||||||| | || ||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
5570887 |
aatttatccc-gtgagcttagctcagttggttgggatattgcatgttatatgcaggggtcggagttcgaaccccggacaccccacttctccacaattaaa |
5570985 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
| ||||| ||||||||||||| |||| |
|
|
| T |
5570986 |
ttatgtgagctctagccactagactac |
5571012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 149 - 242
Target Start/End: Complemental strand, 6942577 - 6942483
Alignment:
| Q |
149 |
gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| ||||||||||||| |||| |
|
|
| T |
6942577 |
gggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactagactac |
6942483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 35939479 - 35939605
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||| |||| |||||||||||||| ||||| ||| | |
|
|
| T |
35939479 |
aattcatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcaaaccgtggacaccccacttcaccacaattaaa |
35939578 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||||| ||||| |
|
|
| T |
35939579 |
ttgtgtgagttctagccactaagctac |
35939605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 118 - 242
Target Start/End: Original strand, 37708683 - 37708809
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-at |
215 |
Q |
| |
|
|||| |||| ||||| |||||||| |||||||||||| ||||| ||||||||||| |||| ||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
37708683 |
atttgtccccgtgagcttagctcaattggtagggataagtgcattttatatgcaggggccggggttcgaaccccggacatcccacttctccacatttaaa |
37708782 |
T |
 |
| Q |
216 |
atgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| ||| |||||||||||||| |
|
|
| T |
37708783 |
atgtgtgagctccagccactaggctac |
37708809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 43656032 - 43656154
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||| ||| | || |||||||||| |||||| |||||||||||| ||||| ||| |
|
|
| T |
43656032 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggtcggggttcgaacctcggacattccacttctccacaatttaattgt |
43656131 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||| |||| |
|
|
| T |
43656132 |
gtgagctctagccactagactac |
43656154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 5326243 - 5326122
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||||||| |||||||||| |||| ||||||||||||||||| ||||||||||| | ||| | |||| |
|
|
| T |
5326243 |
atccccgtgagcttagctcagttggtagagatattgcattttatatgcagaggccggtgttcgaaccccggacactccacttctccataattaaattgtg |
5326144 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
5326143 |
tgaactctagccactagactac |
5326122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 7764000 - 7763891
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||| | || |||| |||||||||||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
7764000 |
ttagctcagttggtagagatattgcatattatatgcaggggccgggatttgaactccggacaccccacttctccacaattaaattgtgtgagctctagcc |
7763901 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||| ||||| |
|
|
| T |
7763900 |
actaagctac |
7763891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 11127912 - 11128020
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| ||| |||||||||||||||||| |||||| |||||| ||| | ||||||| |||||||| |
|
|
| T |
11127912 |
ttagctcagttggtaggaatattgcatattatatacaggatccg-ggttcgaaccccggacactccacttttccacaattaaattgtgtgagctctagcc |
11128010 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
11128011 |
actaggctac |
11128020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 38955267 - 38955146
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||| | ||||||| ||| ||| | |||| |
|
|
| T |
38955267 |
atccccgtgagcttaactcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacactcgacttctctacaattaaattgtg |
38955168 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
38955167 |
tgagctctatccactaggctac |
38955146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 41458298 - 41458407
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||| || | | |||||||| ||||||| ||||||||||||||||| |||||||| || |
|
|
| T |
41458298 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggggctgggtttcgaacctcggacactccacttctccacatttaaatgtgtgagctt |
41458397 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
||||||||| |
|
|
| T |
41458398 |
cagccactag |
41458407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 44340418 - 44340297
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
44340418 |
atccccgtgagcttagctcagttggtagggatattgcatattataaacaggagtcgggattcgaaccccggacactccacttctccacaattaaattgtg |
44340319 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || ||| ||||||||||| |
|
|
| T |
44340318 |
tgagctatagtcactaggctac |
44340297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 116 - 242
Target Start/End: Complemental strand, 38745358 - 38745230
Alignment:
| Q |
116 |
gaatttatccctgtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||||||||| ||||||||| | ||| ||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
38745358 |
gaatgtatccccgtgagcttagctcagttggtagggatattgcatatttatatgcatgggccagggttcgaacccaggacaccccacttctccacaatta |
38745259 |
T |
 |
| Q |
215 |
ta-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
| ||||||| |||||||||||| |||| |
|
|
| T |
38745258 |
aattgtgtgatttctagccactagactac |
38745230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 138 - 238
Target Start/End: Complemental strand, 41616423 - 41616323
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| ||||||||||||||| || ||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
41616423 |
ctcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccggatactccacttctccacattataatgtgtgagctccagccactag |
41616324 |
T |
 |
| Q |
238 |
g |
238 |
Q |
| |
|
| |
|
|
| T |
41616323 |
g |
41616323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 128 - 239
Target Start/End: Complemental strand, 43856449 - 43856337
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||| |||||||||||| ||||| |||| || || |
|
|
| T |
43856449 |
gtgagcttaactcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgagagct |
43856350 |
T |
 |
| Q |
227 |
ctagccactaggc |
239 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
43856349 |
ctaaccactaggc |
43856337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 234
Target Start/End: Original strand, 10573104 - 10573211
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||| |||| |||||||||||| ||||| |||| || || |
|
|
| T |
10573104 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccgaacactccacttctccacaatttaattgtgcgagct |
10573203 |
T |
 |
| Q |
227 |
ctagccac |
234 |
Q |
| |
|
|||||||| |
|
|
| T |
10573204 |
ctagccac |
10573211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 237
Target Start/End: Complemental strand, 20540179 - 20540064
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||||||||||||||| || | |||||||| ||||||||| || |||| || |||||||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattatatgcaggggctggggttcgaattccggacaccacatttcttcatatttatatgtgt |
20540080 |
T |
 |
| Q |
222 |
gaactctagccactag |
237 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
20540079 |
gagttctagccactag |
20540064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 141 - 242
Target Start/End: Complemental strand, 21548552 - 21548449
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagcc-gaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||| | ||||||||||||| ||||||||||||||||| ||| | |||||||| |||||||||||||| |
|
|
| T |
21548552 |
agttggtagggatattgcatattatatgccggggccgggggttcgaaccccgaacaccccacttctccacaattaaaatgtgtgagctctagccactagg |
21548453 |
T |
 |
| Q |
239 |
ctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
21548452 |
ctac |
21548449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 29260622 - 29260737
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||| ||||||||||||||||||||||||||||||| || || ||||||||||||||| |||||||||||| ||| | ||||||| || |
|
|
| T |
29260622 |
gtgagcttaactcagctggtagggatattgcatattatatgcaggagtcggggctcgaaccccggacacttcacttctccacaattaaattgtgtgagct |
29260721 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
29260722 |
ctagccattaggctac |
29260737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 43846933 - 43847052
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||||||||| || ||||||||| ||| | |||||||| | |||||||| | ||| |||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
43846933 |
tccctgtgagcttggctcagttgacaggaacattgcataatttatgcaggggtcgatgttcgaaccctggacaccccacttctccacatttaattgtgtg |
43847032 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
43847033 |
agctctagccactaggctac |
43847052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 118 - 212
Target Start/End: Original strand, 39362258 - 39362352
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||| | | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
39362258 |
atttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagaggttggagttcgaaccccagacaccccacttctccacatt |
39362352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 229
Target Start/End: Complemental strand, 8698647 - 8698546
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||| | | |||||||| |||||||||||||||||| |||||||| || ||||| ||| |
|
|
| T |
8698647 |
gtgagcttagctcagttggtagggatattgcatattatatgtaggggttggggttcgaatcccggacaccccacttcttcacatttaaatatgtgagctc |
8698548 |
T |
 |
| Q |
228 |
ta |
229 |
Q |
| |
|
|| |
|
|
| T |
8698547 |
ta |
8698546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 9187296 - 9187175
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||| |||||||| || | || |||||||||||| |||| ||||||||||||| ||| | |||| |
|
|
| T |
9187296 |
atccccgtgagcttagctcagttggtagggatattacattttatatgctggggtcggggttcgaacccccaacactccacttctccacaattaaattgtg |
9187197 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
9187196 |
tgagctctagccactaggctac |
9187175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 32258010 - 32258119
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||| || | ||||||||||| || |||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
32258010 |
gtgagattagctcagttggtagggatattgcatattctatgcgggggtcgaggttcgaatcctggacaccccacttctccacaattaaattgtgtgagct |
32258109 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
||| |||||| |
|
|
| T |
32258110 |
ctaaccacta |
32258119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 32719680 - 32719560
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||| ||||||||| |||||| |||||| ||| | |||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg-gttggggttcgaatcccggacactccacttttccacaattaaattgtg |
32719582 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
32719581 |
tgagctctaaccactaggctac |
32719560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 37090686 - 37090566
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| |||||||||||||||| || |||||||||||| |||| |||| |||||||| ||| | | || |
|
|
| T |
37090686 |
atccccgtgagtttaactcagttggtagggatattgtatattatatgcaggagtcggggttcgaacccc-aacactccacatctccacaattaaattatg |
37090588 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
37090587 |
tgagctctagccactaggctac |
37090566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 39587544 - 39587665
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||||||| |||||| |||| | || | ||||||||| |||||| ||||||||||||| ||| | |||| |
|
|
| T |
39587544 |
atccccgtgagcttagctcagttggtagagatattgcattttatattcaggggtcgggattcgaaccctggacactccacttctccacaattaaattgtg |
39587643 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
39587644 |
tgagctctagccactaggctac |
39587665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 43085296 - 43085175
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||| |||||||| ||| ||||||||||| |||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
43085296 |
atccccgtgagcttagctcagttgggagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtg |
43085197 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
| | ||||| |||||||||||| |
|
|
| T |
43085196 |
taagctctaaccactaggctac |
43085175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 129 - 235
Target Start/End: Complemental strand, 4654176 - 4654068
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc-ggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||| | ||| ||||||||||||| |||||| |||||||||||| ||||| ||||||| || |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatgcaagggccaaggttcgaacccctggacactccacttctccacaatttaattgtgtgagct |
4654077 |
T |
 |
| Q |
227 |
ctagccact |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
4654076 |
ctagccact |
4654068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 8969092 - 8969180
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| |||||| |||||| |||||||||| |||||||||||||||||||||||| | |||||||||| ||||||| ||||||||||||| |
|
|
| T |
8969092 |
atccatgtgagcttagctaagttggtaggaatattgcatattatatgcaggagctggggttcgaacctcggacactccacttctccaca |
8969180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 13059249 - 13059129
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgt |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| | |||||| | |||||||| || | |||||||||||| |||||||||||||||||||||| | |||||| |
|
|
| T |
13059249 |
tccccgtgagcttagctcagttggtagggacaatgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccacatttaaaatgtgt |
13059150 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
| ||| |||||||||||||| |
|
|
| T |
13059149 |
gtgctccagccactaggctac |
13059129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 135 - 211
Target Start/End: Complemental strand, 13773452 - 13773376
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacat |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
13773452 |
tagctcagttggtagagatattgcatattatatgtaggagccggggttcgaaccccggacacttcacttctccacat |
13773376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 26280857 - 26280769
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||| |||||||| ||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
26280857 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgccggagccggggttcgaaccccgaacactccacttctccaca |
26280769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 4615743 - 4615628
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||| |||||||| |||| ||| | |||||||||| |
|
|
| T |
4615743 |
gtgagtttagttcagttggtagggatattgcatattatatgcaggagcttgggtttgaacctcggacactccacttcttcacaattaaattgtgtgaact |
4615644 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
| || |||||||||| |
|
|
| T |
4615643 |
caaggaactaggctac |
4615628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 7765646 - 7765761
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||| ||||||| |||||||||||||||||||| |||||||||||| ||||| ||| ||||||||| ||| | ||||||| || |
|
|
| T |
7765646 |
gtgagcttagctcagttggtatggatattacatattatatgcaggagccggggttcgaaccccagacactccatttctccacaattaaattgtgtgagct |
7765745 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|| ||| |||||||| |
|
|
| T |
7765746 |
ttaaccaataggctac |
7765761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 34472300 - 34472415
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||| |||||| |||||| ||| | ||||||| || |
|
|
| T |
34472300 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagttggggttcgaaccccagacactccacttttccacaattaaattgtgtgagct |
34472399 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| ||||||| |||| |
|
|
| T |
34472400 |
ctaaccactagactac |
34472415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 117 - 242
Target Start/End: Complemental strand, 8862204 - 8862078
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttat |
215 |
Q |
| |
|
||||||| |||||||| |||||| |||||||||||||||||||||||||||||||| | | ||||||||| |||||||| |||||| ||||| ||||| |
|
|
| T |
8862204 |
aatttattcctgtgagcttagctaagttggtagggatattgcatattatatgcaggggtcagggttcgaactccggacactccacttttccacaatttaa |
8862105 |
T |
 |
| Q |
216 |
atgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| | |||||||||| |||||| |
|
|
| T |
8862104 |
ttgtgtaagttctagccacttggctac |
8862078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 140 - 233
Target Start/End: Complemental strand, 8953924 - 8953831
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||| | |||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
8953924 |
cagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggaca-ctcacttctccacaattaaattgtgtgagctctagcca |
8953831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 10594283 - 10594201
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||| | |||||||||||||||||||| |||||||||||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
10594283 |
gtgagcttagtttagttggtagggatattgcattttatatgcaggagccggggttcgaaccccgtacactccacttctccaca |
10594201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 15856573 - 15856459
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| ||||||||||||||| |||||||| | ||| |||| ||| ||||| |||| ||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
15856573 |
gtgagcttaactcagttggtagggacattgcataatttatacagggaccggggttcaaacctcggacaccccacttctccacatttaattgtgtgagctc |
15856474 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
15856473 |
taaccactaggctac |
15856459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 33810635 - 33810757
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggat-attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatg |
218 |
Q |
| |
|
|||||| |||||||| | |||||||||||||| | ||||| ||||||||||| |||| ||||| ||||||||||||||||||||||||||||| | ||| |
|
|
| T |
33810635 |
tatcccggtgagttttgttcagttggtagggaccaatgcattttatatgcaggggccggggttcaaaccccggacaccccacttctccacatttaaaatg |
33810734 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||| ||| |||||||| |||| |
|
|
| T |
33810735 |
tgtgagctccagccactaagcta |
33810757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 234
Target Start/End: Complemental strand, 10587338 - 10587237
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||| ||||||| |||||||||||||||||||||| ||| | ||| ||| |||||||| |
|
|
| T |
10587338 |
ttagctcagttggtagggatattgcatattatatgcaaaggtcgagattcgaactccggacaccccacttctccacaattaaattgtatgagctctagcc |
10587239 |
T |
 |
| Q |
233 |
ac |
234 |
Q |
| |
|
|| |
|
|
| T |
10587238 |
ac |
10587237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 133412 - 133500
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||||||||||||||||| || ||||||||| ||| |||| |||||| |||||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggagtcggggttcgaactccgaacactccacttttccaca |
133500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 233
Target Start/End: Original strand, 11231424 - 11231528
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||| ||| ||| ||||||| |||| |
|
|
| T |
11231424 |
tgagcttagctcagttgaaagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctcgacaattaattgtgtgagctct |
11231523 |
T |
 |
| Q |
229 |
agcca |
233 |
Q |
| |
|
||||| |
|
|
| T |
11231524 |
agcca |
11231528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 11483130 - 11483237
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| || |||||||||| ||||||| ||||||||||||| ||| | ||| ||| |||||||| |
|
|
| T |
11483130 |
tagctcagttagtaggaatattgcatattatatgcaggag-cggggttcgaacctcggacactccacttctccacaattaaattgtatgagctctagccg |
11483228 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
11483229 |
ctaggctac |
11483237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 208
Target Start/End: Original strand, 40362051 - 40362131
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||| | || |||||||||| ||||||| ||||||||||| |
|
|
| T |
40362051 |
gtgagcttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacctcggacactccacttctcca |
40362131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 29729114 - 29729237
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc-ggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||| |||| | |||||||||||| ||||| |||||||||||| ||||| || |
|
|
| T |
29729114 |
tatccccgtgagtttagttcagttggtagggatattgcatattatatacaggggttagggttcgaaccccaagacactccacttctccacaatttaattg |
29729213 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||| ||||||||||| |
|
|
| T |
29729214 |
tgtgagctctagtcactaggctac |
29729237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 43980380 - 43980265
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||| ||||||| |||||||||||||||||||||||||| || |||||||||||||||||| | |||||||||| ||||| ||||||| || |
|
|
| T |
43980380 |
gtgagcttagttcagttgttagggatattgcatattatatgcagggatcggggttcgaaccccggacactcaacttctccacaatttaattgtgtgagct |
43980281 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
43980280 |
ttagccactacgctac |
43980265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 44673715 - 44673600
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||| ||| ||||||||||| | || |||||||||||| ||||| |||||| |||||| ||| | ||||||| || |
|
|
| T |
44673715 |
gtgagcttagctcagttggtagggatatcacattttatatgcaggggtcggggttcgaaccccagacactccacttttccacaattaaattgtgtgagct |
44673616 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
44673615 |
ctagccactagactac |
44673600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 241
Target Start/End: Original strand, 41272092 - 41272210
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| |||||| ||||||| || ||||||| |||||||| | |||||||| || | ||||||||| | |||||| ||||||||||||||||| ||||||| |
|
|
| T |
41272092 |
tccccgtgagtatagctcaattagtagggacattgcataatttatgcaggggctggggttcgaactctggacacaccacttctccacatttaaatgtgtg |
41272191 |
T |
 |
| Q |
223 |
aactctagccactaggcta |
241 |
Q |
| |
|
| ||| |||||||||||| |
|
|
| T |
41272192 |
agctcccgccactaggcta |
41272210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 120 - 205
Target Start/End: Complemental strand, 2294174 - 2294089
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
||||||| |||||||||||||| ||| |||||||||| ||||||||||||||| | || |||||||||||| ||||||||| |||| |
|
|
| T |
2294174 |
ttatccccgtgagtttagctcaattgatagggatattacatattatatgcaggggtcggggttcgaaccccagacaccccatttct |
2294089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 123 - 203
Target Start/End: Complemental strand, 19957422 - 19957341
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| |||||||| |||||| |||||| ||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
19957422 |
tccctgtgaacttagctcacttggtaagggataatgcatattatatgcaggggacgaggttcgaaccccggacaccccactt |
19957341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 24480878 - 24480773
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| || | |||||||||| |||||||||||||||||||| ||| | | ||||| |||||||||||| |
|
|
| T |
24480878 |
ctcagttggtagagatattgtatattatatgcaggggctggggttcgaaccttggacaccccacttctccacaattaaattatgtgagctctagccacta |
24480779 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
| |||| |
|
|
| T |
24480778 |
gactac |
24480773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 133 - 210
Target Start/End: Complemental strand, 30925427 - 30925350
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| ||||||| |||||||| | |||||| ||||||||||||| |
|
|
| T |
30925427 |
tttagctcagttgatagggatattgaatattatatgcaagagccgaagttcgaacgctggacactccacttctccaca |
30925350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 31024291 - 31024412
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | | ||| ||||| ||||| || | ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
31024291 |
tccccgtgagctttgctcagttggtagggacaaattcattttatacgcaggggctggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
31024390 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
31024391 |
tgagctccagccactaggctac |
31024412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 36035252 - 36035131
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
||||| ||||| |||||||| ||||||| | ||||| ||||||||||| | || |||||||||| |||||||||||||||||||||||| | ||||| |
|
|
| T |
36035252 |
atccccgtgagcttagctcaattggtagaataaatgcattttatatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaaaatgtg |
36035153 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
36035152 |
tgagctccagccactaggctac |
36035131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 37092088 - 37092209
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||| || ||| ||||||||||||| | ||| | ||||||||| ||| | |||| |
|
|
| T |
37092088 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgctggggccagggttcgaaccccgaataccttatttctccacaattaaattgtg |
37092187 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||| |||||||||| |
|
|
| T |
37092188 |
tgagctctagttactaggctac |
37092209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 134 - 237
Target Start/End: Original strand, 3227243 - 3227347
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |||||||| | ||||||||||||||| ||| |||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
3227243 |
ttagctcagttggtagagatattagatattttatgcagggactgaggttcgaaccccgaacatcccacttctccacaattaaattgtgtgagctctagcc |
3227342 |
T |
 |
| Q |
233 |
actag |
237 |
Q |
| |
|
||||| |
|
|
| T |
3227343 |
actag |
3227347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 25812270 - 25812162
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||| |||| ||||| |||||||| | |||| ||| ||| |||||||||||| ||||||||||||||| ||||||| ||||||| ||||| ||| |
|
|
| T |
25812270 |
ttagctcaattggcagggacattgcataatttatggagggtccggggttcgaaccccagacaccccacttctcaacatttaattgtgtgagctctaacca |
25812171 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
25812170 |
ctaggctac |
25812162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 138 - 214
Target Start/End: Original strand, 40740538 - 40740613
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| || ||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
40740538 |
ctcagttgatagggatattgcatattatatgcaggggcgtagg-tcgaacctcggacaccccacttctccacattta |
40740613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 127 - 238
Target Start/End: Complemental strand, 3949149 - 3949038
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||| | || | | |||| || | ||||||||||||||||||||| ||| ||||||| || |
|
|
| T |
3949149 |
tgtgagcttaactcagttggtagggatattgcatattatatactggggttggagttcaaatctcggacaccccacttctccacaattaattgtgtgagct |
3949050 |
T |
 |
| Q |
227 |
ctagccactagg |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3949049 |
ctagccactagg |
3949038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 13105093 - 13105180
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||| ||| ||||||||||||||| | |||||| |||||||| | |||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13105093 |
tgtgagattaactcagttggtagggacaatgcataatatatgcaagggccggggttcgaacctcagacaccccacttctccacattta |
13105180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 23261304 - 23261419
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||| ||||||||||||||| |||| | ||||||||| ||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
23261304 |
gtgagcttagctgagttggtagggatatcgcatttcatatgcagggaccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
23261403 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| | ||||| |||| |
|
|
| T |
23261404 |
ctacctactagactac |
23261419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 24296935 - 24296829
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||| | | ||||||||||| |||||||||||||||||| ||| | ||||||| | |
|
|
| T |
24296935 |
gtgagcttagctcagttagtagggatattgcatattatatgcaggggttggggttcgaaccc---acaccccacttctccacaattaaattgtgtgagtt |
24296839 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
24296838 |
ctagccacta |
24296829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 120 - 229
Target Start/End: Complemental strand, 2168522 - 2168412
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| ||| |||||| |||| ||||| ||||||| || ||||| |||| |||||||| ||| | || |
|
|
| T |
2168522 |
ttatccccgtgagcttagctcagttggtagggatattacattttatatacaggtgccgatgttcgaataccagacactccacctctccacaattaaattg |
2168423 |
T |
 |
| Q |
219 |
tgtgaactcta |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
2168422 |
tgtgaactcta |
2168412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 11787155 - 11787269
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||| ||||||||||| ||||||| |||||||||| ||| |||| ||||| |||||||||||| ||||||||||||| ||| | | ||||| ||| |
|
|
| T |
11787155 |
tgagcttaactcagttggtatggatattacatattatatataggggccgtggttcaaaccccggacactccacttctccacaattaaattatgtgagctc |
11787254 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
11787255 |
taaccactaggctac |
11787269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 18926209 - 18926087
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||||| |||| ||||||||||| || | | |||||||||||||||| |||||||||||| ||| | ||| |
|
|
| T |
18926209 |
tatccccgtgaccttagctcaattggtagggatatcgcattttatatgcaggggcagggattcgaaccccggacacttcacttctccacaattaaattgt |
18926110 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||| ||| |||| |
|
|
| T |
18926109 |
gtgagctctagccattagactac |
18926087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 23339963 - 23339881
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| |||||||||||| ||||||| |||||||||| ||| |||| ||||||||||| ||||||||||||||| |||| |
|
|
| T |
23339963 |
gtgagcttaactcagttggtagagatattgtatattatatgtaggggccggggttcgaaccctggacaccccacttcttcaca |
23339881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 136 - 242
Target Start/End: Complemental strand, 25824961 - 25824855
Alignment:
| Q |
136 |
agctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||| |||||||||| |||||||| | |||||| | | || |||||||||||| ||||||||||||||| |||| || ||||||| ||||||||||| |
|
|
| T |
25824961 |
agctcaattggtagggacattgcataatttatgcaagggtcggggttcgaaccccagacaccccacttctcaacatataattgtgtgagctctagccact |
25824862 |
T |
 |
| Q |
236 |
aggctac |
242 |
Q |
| |
|
| ||||| |
|
|
| T |
25824861 |
aagctac |
25824855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 26796961 - 26797046
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| | |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
26796961 |
gtgagtttagctcagttggtagggacattgcatattttatgcagggactgaggttcgaa-ttcggacaccccacttcttcacattta |
26797046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 180 - 242
Target Start/End: Original strand, 26823725 - 26823787
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26823725 |
gttcgaaccccggacaccacccttctccacatttatatgtgtgagctccagccactaggctac |
26823787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 149 - 242
Target Start/End: Complemental strand, 31153065 - 31152971
Alignment:
| Q |
149 |
gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||| ||| | | ||||||||||| |||||||||||||||||||| ||| | ||||||| ||||||||| |||||||| |
|
|
| T |
31153065 |
gggatattgcatattatatgtaggggtcagggttcgaaccctggacaccccacttctccacaattaaattgtgtgagctctagccattaggctac |
31152971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 208
Target Start/End: Original strand, 36540284 - 36540370
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||| ||||||||||| | || |||||||||||| |||| ||||||||||| |
|
|
| T |
36540284 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccaaacactccacttctcca |
36540370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 141 - 242
Target Start/End: Original strand, 38774087 - 38774189
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtgaactctagccactaggc |
239 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| || ||||||||| ||||||| ||||||||||||| ||| || |||||| ||||||||||||||| |
|
|
| T |
38774087 |
agttggtggggatattgcattttatatgcagggatcggggttcgaacttcggacactccacttctccacaattaaatcgtgtgagctctagccactaggc |
38774186 |
T |
 |
| Q |
240 |
tac |
242 |
Q |
| |
|
||| |
|
|
| T |
38774187 |
tac |
38774189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 41689875 - 41689929
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689875 |
atttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
41689929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 43053952 - 43053870
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| ||||||||||||||||||| ||||||||||||||||| || |||||||| ||||||| ||||||||||||| |
|
|
| T |
43053952 |
gtgagcttaactcagttggtagggatatttcatattatatgcaggagtcggggttcgaatttcggacactccacttctccaca |
43053870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 203
Target Start/End: Complemental strand, 7109351 - 7109283
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||| ||||| |||| ||||||||||| |
|
|
| T |
7109351 |
ttagctcagttggtagagatattgcatattatatgcaggggccgaggctcgaa-cccgaacaccccactt |
7109283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 206
Target Start/End: Original strand, 22717795 - 22717872
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||| |||||||||||| ||| | |||||||| | |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22717795 |
tgagcttagctcagttgaaaggaacattgcataatttatgcaggggccgaggttcgaaccccggacaccccacttctc |
22717872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 36572918 - 36573026
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||||||| || || ||||| || |||||| | |||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
36572918 |
ttagctcagttggtaggaatattgcttagtatatgcagaagacgtggttc-aatcccggatatcccacttctccacaattaaattgtgtgaactctagcc |
36573016 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||| ||||| |
|
|
| T |
36573017 |
actacgctac |
36573026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 37524268 - 37524159
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||| |||| | |||| ||||||||||| | ||| | ||||||| ||||||| |
|
|
| T |
37524268 |
ttagctcagttggtagagatattgcatattatatgcagaggccgaggttcaaacctcatacactccacttctccataattaaattgtgtgagctctagcg |
37524169 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||| ||||| |
|
|
| T |
37524168 |
actaagctac |
37524159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 120 - 172
Target Start/End: Complemental strand, 12300 - 12248
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12300 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
12248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 203
Target Start/End: Complemental strand, 4798636 - 4798561
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
4798636 |
gtgagtatagctcagttggtagg-ataatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
4798561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 142 - 210
Target Start/End: Original strand, 9370185 - 9370253
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | ||||||||||||||||||| ||||| |||||| |
|
|
| T |
9370185 |
gttggtagggatattgcatattatatgcaggggtcagggttcgaaccccggacacctcacttatccaca |
9370253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 237
Target Start/End: Original strand, 14583194 - 14583310
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtg |
220 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||| | |||||| |||||||||| || | |||||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
14583194 |
tcccagtgagcttaactcagttggtagggacaaatgcataatatatgcaggggctggggttcgaaccacgaacaccccacttctccacattaaatatgtg |
14583293 |
T |
 |
| Q |
221 |
tgaactctagccactag |
237 |
Q |
| |
|
||| ||| ||||||||| |
|
|
| T |
14583294 |
tgagctccagccactag |
14583310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 118 - 237
Target Start/End: Complemental strand, 33604249 - 33604135
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata- |
216 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||| |||||| |||||| | |||||||| ||||||||| ||||||||||||| ||| | |
|
|
| T |
33604249 |
atttatccccgtgagcttagctcagttggtagggatattg-atattacatgcag-----ggggttcgaatcccggacactccacttctccacaattaaat |
33604156 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
33604155 |
tgtgtgagttctagccactag |
33604135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 39674131 - 39674011
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| |||||||||||| || | |||| ||| ||||||||||| | | ||||||||||| ||||||||||||||| |||||||| ||| | |
|
|
| T |
39674131 |
atccccgtgagcttagctcagttgctatgaatatcacatgttatatgcaggggttggggttcgaaccctggacaccccacttcttcacatttaattgtat |
39674032 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| ||||||||||||| |||| |
|
|
| T |
39674031 |
gagctctagccactagactac |
39674011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 118 - 242
Target Start/End: Complemental strand, 41865159 - 41865035
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat |
217 |
Q |
| |
|
|||||| | |||||| |||||||||||||| | |||||| ||||||||||||||| | | |||||||||||| ||||| ||| || |||||||||| | |
|
|
| T |
41865159 |
atttattcttgtgagcttagctcagttggtggagatattacatattatatgcaggggtcagggttcgaaccccagacactccatttttccacatttaatt |
41865060 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| | |||||||||| |||| |
|
|
| T |
41865059 |
gtgtgagttatagccactagactac |
41865035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 216
Target Start/End: Complemental strand, 42511650 - 42511562
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||||||| || |||| ||||| ||||||||||||||| | || |||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
42511650 |
gtgagtttagctcaactgataggaatattacatattatatgcaggggtcggggtttgaaccccgaacaccccatttctccacatttata |
42511562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 44053456 - 44053392
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||| ||| |||||||||||||| |
|
|
| T |
44053456 |
ggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccactaggctac |
44053392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 2114882 - 2115000
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||| |||||||||||| || | | |||||| |||||| | ||| |||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
2114882 |
tccccgtgagcttaactcagttggtagagacaatacatattttatgcaagggcc-aggttcgaactccggacaccccacttctccacatttaattgtgtg |
2114980 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| |||| |
|
|
| T |
2114981 |
ggctccagccactagactac |
2115000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 135 - 201
Target Start/End: Complemental strand, 3190009 - 3189945
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||| |||| |
|
|
| T |
3190009 |
tagctcagttggtagggatattgcatattatatgcag--gtcggggttcgaaccccggacactccac |
3189945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 142 - 236
Target Start/End: Original strand, 9407408 - 9407502
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | |||||||||||||| | |||| ||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
9407408 |
gttgatagggatattgcatattatatgcagg-gtcgaggttcgaacccagaacacttcacttctccacaatttaattgtgtgagctctagccacta |
9407502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 17499157 - 17499042
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| | ||||||||||| | ||||| |||| ||||||||||||| |||||||| | |||||| | || |
|
|
| T |
17499157 |
gtgagtttgactcagttggtagggacattgcataatttatgcaggagcaggggttcaaaccattgacaccccacttccccacatttaaaatgtgtcagct |
17499058 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
17499057 |
ctagccactagactac |
17499042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 155 - 242
Target Start/End: Original strand, 31406787 - 31406874
Alignment:
| Q |
155 |
ttgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| | |||||||| |||| |||||||||| |||| ||| |||||||||||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
31406787 |
ttgcataatttatgcaggggccggggttcgaacctcggataccacacttctccacatttaattgtgtgagctctagtcactaggctac |
31406874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 193
Target Start/End: Original strand, 33617969 - 33618040
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccgga |
193 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||||||| | || |||||||||||||| |
|
|
| T |
33617969 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggtgttcgaaccccgga |
33618040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 40322937 - 40322814
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| || ||||||||||||| ||||||||| ||||||| | | |||| |||||||||||| |||| ||||||||||||| ||| | ||| |
|
|
| T |
40322937 |
tatccccgtgagcttggctcagttggtagaaatattgcattttatatgtaagggccggagttcgaaccccgaacactccacttctccacaattaaattgt |
40322838 |
T |
 |
| Q |
220 |
gtga-actctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
40322837 |
gtgagcctctagccactaggctac |
40322814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 121 - 234
Target Start/End: Original strand, 7388451 - 7388565
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||||||||||||||||||| | | ||||| ||| ||| |||| ||| |||||||| ||||| ||| |
|
|
| T |
7388451 |
tatccccgtgaacttaactcagttggtagggatattgcatattatatgcaggggttggggttcaaactccgaacactccatttctccacaatttaattgt |
7388550 |
T |
 |
| Q |
220 |
gtgaactctagccac |
234 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
7388551 |
gtgagctctagccac |
7388565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 241
Target Start/End: Original strand, 8183316 - 8183437
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat--tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgt |
219 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| |||| |||||||||||| |||| |||||||||||| |||| | |||| |
|
|
| T |
8183316 |
tccccgtgagctttgctcagttggtagggacaaaatgcattttatatgcaggggccggggttcgaaccccagacaacccacttctccatatttaaaatgt |
8183415 |
T |
 |
| Q |
220 |
gtgaactctagccactaggcta |
241 |
Q |
| |
|
|||| ||| ||||| ||||||| |
|
|
| T |
8183416 |
gtgagctccagccattaggcta |
8183437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 209
Target Start/End: Complemental strand, 10557565 - 10557483
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
10557565 |
tgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
10557483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 11289490 - 11289408
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||| ||| || | ||||||||||| ||||| ||||||||||||| |
|
|
| T |
11289490 |
gtgagtttagctcatttgatagggatattgcattttatatgtaggggctggggttcgaaccctggacattccacttctccaca |
11289408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 22437857 - 22437772
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | |||||||| | || ||||||||||| |||||| || ||||||||||||| |
|
|
| T |
22437857 |
gtgagcttagctcagttggtagggatattgcataatttatgcaggggttga-gttcgaaccccagacacctcagttctccacattta |
22437772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 136 - 242
Target Start/End: Original strand, 29499589 - 29499693
Alignment:
| Q |
136 |
agctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| | | ||||||||| ||||| | |||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
29499589 |
agctcagttggtagggatattgcatgttatatgtagggtcgggggttcgaactccggata-cccacttctccacattta-aaatgtgagctctagccact |
29499686 |
T |
 |
| Q |
236 |
aggctac |
242 |
Q |
| |
|
|| |||| |
|
|
| T |
29499687 |
agactac |
29499693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 156 - 237
Target Start/End: Original strand, 34873117 - 34873199
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||| ||||||||||| | || |||||||||| |||||||||||||||||||||||| | |||||||| ||| ||||||||| |
|
|
| T |
34873117 |
tgcattttatatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaaaatgtgtgagctccagccactag |
34873199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 149 - 242
Target Start/End: Original strand, 40298716 - 40298810
Alignment:
| Q |
149 |
gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||| || ||||||||| | | || |||||||||||||||||| || ||||||||| ||||| ||||||||||||||||||||| |||| |
|
|
| T |
40298716 |
gggatattgtattttatatgcaagggtcggggttcgaaccccggacactccgcttctccacaatttaattgtgtgaactctagccactagactac |
40298810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 209
Target Start/End: Original strand, 42877032 - 42877117
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
|||| ||||| |||||||| |||||||||| |||||||| | |||||||| |||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
42877032 |
tccccgtgagcttagctcaattggtagggacattgcataatttatgcaggggccgtggttcgaa-cccgaacaccccacttctccac |
42877117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 44553595 - 44553677
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| ||||||||||| | || |||| ||||||| |||| ||||||||||||| |
|
|
| T |
44553595 |
gtgagtttagctcagttggtaggtataatgcatgttatatgcaggggtcggagttcaaaccccgaacactccacttctccaca |
44553677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 2800025 - 2800094
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
2800025 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
2800094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 139 - 208
Target Start/End: Complemental strand, 11537483 - 11537414
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
11537483 |
tcagttggtaaaaatattacatattatatgcaggagcccgggttcgaaccccggacaccctacttctcca |
11537414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 209
Target Start/End: Original strand, 26734081 - 26734153
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||| |||||||| |||| ||||||||||||||| |
|
|
| T |
26734081 |
ttagctcagttggtagatatattgcatattatatgcaggggccgcggttcgaa---cggataccccacttctccac |
26734153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 33473416 - 33473311
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| || |||||||| ||||||||| ||||||| |||| ||| | ||||||| |||||||| |
|
|
| T |
33473416 |
ttagctcagttggtagggatatcacattttatatgcagggatcggggttcgaatcccggacacttcacttcttcacaattaaattgtgtgagctctagcc |
33473317 |
T |
 |
| Q |
233 |
actagg |
238 |
Q |
| |
|
|||||| |
|
|
| T |
33473316 |
actagg |
33473311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 43403289 - 43403410
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
|||||| |||| ||| ||||||||||| |||||||||||||||||| ||| || | ||||||||| ||||| |||||||||||||| ||| | |||| |
|
|
| T |
43403289 |
atccctatgagcttaattcagttggtagagatattgcatattatatgtaggggctggagttcgaaccttggacatcccacttctccacaattaaattgtg |
43403388 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||| ||||| |||| |
|
|
| T |
43403389 |
tgagctctagctactagactac |
43403410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 129 - 230
Target Start/End: Complemental strand, 44089021 - 44088921
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||| ||| | ||||||||| ||||||||||||||||||| ||||| ||||||| |||| |
|
|
| T |
44089021 |
tgagtttagctcagttggtagagatattgcatgttatatgtagg-gtaagggttcgaacttcggacaccccacttctccatatttaattgtgtgagctct |
44088923 |
T |
 |
| Q |
229 |
ag |
230 |
Q |
| |
|
|| |
|
|
| T |
44088922 |
ag |
44088921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 11872063 - 11872151
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||| || ||| ||||||||| |||||| ||| ||||||||||| |||| |||| |||||||| |||| ||||||||||||| |
|
|
| T |
11872063 |
atccccgtgagctttgcttagttggtagagatattacattttatatgcaggggccggggtttgaaccccgaacactccacttctccaca |
11872151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 208
Target Start/End: Complemental strand, 18452352 - 18452272
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||||||||| ||||||||||||||| ||| || |||| |||| |||||| |
|
|
| T |
18452352 |
gtgagcttagctcagttgttaggaatattgcatattatatacaggagccgaggttcaaactccatacactccacatctcca |
18452272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 235
Target Start/End: Original strand, 38402249 - 38402361
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||||||| |||||| | | ||||| ||||||||| | |||||||| |||| ||| |||||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattatttgcaggggttggggttcaaaccccggatattccacttcttcacaattaattgtgtg |
38402348 |
T |
 |
| Q |
223 |
aactctagccact |
235 |
Q |
| |
|
| ||||| ||||| |
|
|
| T |
38402349 |
agctctaaccact |
38402361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 40393327 - 40393407
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| |||| ||| |||||||||| | |||||||| | || ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
40393327 |
ttagctcaattggcaggaatattgcataatttatgcaggggtcggggttcgaaccccgaacacccctcttctccacattta |
40393407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 42877398 - 42877322
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| | | || ||||||| | ||||||||||||||||||| |
|
|
| T |
42877398 |
ttagctcagttggtagagatattgtatattatatgcagggggccggggtcgaacctcagacaccccacttctccaca |
42877322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 7314765 - 7314808
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7314765 |
tattatatgcaggggccgaggttcgaaccccggacaccccactt |
7314808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 236
Target Start/End: Complemental strand, 11406740 - 11406637
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||| || || |||| ||||||||||||||||| || | | |||||||||||| ||||||| ||||||||||||||| | ||||||||||| || || |
|
|
| T |
11406740 |
ttagcttagctgctaggaatattgcatattatatgtgggggtcaaggttcgaaccctggacacctcacttctccacatttaaaatgtgtgaactttaacc |
11406641 |
T |
 |
| Q |
233 |
acta |
236 |
Q |
| |
|
|||| |
|
|
| T |
11406640 |
acta |
11406637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 237
Target Start/End: Original strand, 13450459 - 13450561
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||| ||| |||||||||||| ||||| ||||||||||||| ||| || |||| ||||| ||| |
|
|
| T |
13450459 |
ttagctcaattggtagg-atattacatattatatgcagaggccagggttcgaaccccagacactccacttctccacaattaaattggtgagctctaacca |
13450557 |
T |
 |
| Q |
234 |
ctag |
237 |
Q |
| |
|
|||| |
|
|
| T |
13450558 |
ctag |
13450561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 150 - 236
Target Start/End: Complemental strand, 13749064 - 13748977
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||||||||||| || | ||||| ||||||||||||||||||| || || ||| | |||||||| |||||||||||| |
|
|
| T |
13749064 |
ggatattgcatattatatgcagaggcaggggttcaaaccccggacaccccacttttctacgtttaaaatgtgtgagctctagccacta |
13748977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 119 - 202
Target Start/End: Original strand, 19163857 - 19163940
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||||||| ||||||| || |||| || |||||||||||||| |||| |
|
|
| T |
19163857 |
tttatccttgtgaacttaactcagttggtagggatattgcatataatatgcaagaatcgagatttgaaccccggacaccacact |
19163940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 26395360 - 26395483
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgca-ggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
|||||| |||| ||| |||||||| || ||||||||||| ||||||||| || || | |||||||||||| ||||||||| ||||||||| ||| | || |
|
|
| T |
26395360 |
tatccccgtgaacttatctcagttgataaggatattgcattttatatgcagggggctggggttcgaaccccagacaccccatttctccacaattaaattg |
26395459 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| || |||||||||||||| |
|
|
| T |
26395460 |
tgtgagctacagccactaggctac |
26395483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 29170768 - 29170883
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
|||| |||| || |||||||| ||||||| || ||||||||||||| || ||||||| |||||| |||||||||||||||| ||| | ||||||| | |
|
|
| T |
29170768 |
gtgattttatcttagttggtatggatatttgatgttatatgcaggagtcggagttcgaatcccggataccccacttctccacaattaaattgtgtgagtt |
29170867 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
29170868 |
ctagccactagactac |
29170883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 30300327 - 30300418
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||| ||||||||||||| || || |||||| |||||||||| |||| ||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
30300327 |
tcccagtgagcttagctcagttggaagagacgatgcataatatatgcaggggccggggttcgaaccccggaaaccctacttctccatattta |
30300418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 232
Target Start/End: Original strand, 42035333 - 42035444
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| || |||||| |||||||| || ||||||| |||||||||||||| || | |||||||||||| ||||| | |||||||||| ||||| |||| |
|
|
| T |
42035333 |
atccccgtaagtttaactcagttgataaagatattgtatattatatgcaggggctggggttcgaaccccagacactctacttctccacaatttaattgtg |
42035432 |
T |
 |
| Q |
221 |
tgaactctagcc |
232 |
Q |
| |
|
||| |||||||| |
|
|
| T |
42035433 |
tgagctctagcc |
42035444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 197132 - 197054
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||| ||| | | | |||||||| ||||||| |||||||| |
|
|
| T |
197132 |
tgtgagcttagctcagttggtagggatattgcatataatatgtaggggttgggattcgaaccgcggacactccacttct |
197054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 311969 - 311891
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||| ||| | | | |||||||| ||||||| |||||||| |
|
|
| T |
311969 |
tgtgagcttagctcagttggtagggatattgcatataatatgtaggggttgggattcgaaccgcggacactccacttct |
311891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 138 - 203
Target Start/End: Original strand, 2696542 - 2696608
Alignment:
| Q |
138 |
ctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
2696542 |
ctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
2696608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 9814042 - 9813920
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgt |
219 |
Q |
| |
|
|||||| ||||||||| |||| ||||| |||||||||||||||||||||| | |||||||||||| ||||||| ||| |||| |||||| | || | |
|
|
| T |
9814042 |
tatccccgtgagtttaactcaattggtctggatattgcatattatatgcagagactgaggttcgaacctcggacactccagttctttacatttaaaatat |
9813943 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|| | ||||||||||||| |||| |
|
|
| T |
9813942 |
gtaagctctagccactagactac |
9813920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 14582505 - 14582393
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||| ||| | || |||||||||||| ||||| ||| ||||| || || || ||||||| ||| |
|
|
| T |
14582505 |
tgagtttaactcagttgttagggatattgcatattatatggagg-gtcggggttcgaacccc-gacactccatttctcaacaatgtaactgtgtgagctc |
14582408 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
14582407 |
tagccactagcctac |
14582393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 125 - 223
Target Start/End: Complemental strand, 20872528 - 20872431
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||||| | |||||||| | || ||||||| |||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
20872528 |
cctgtgagcttagctcagttgatagggacattgcataatttatgcaggggtcggagttcgaatcccgaacaccccacttc-ccacatttaattgtgtga |
20872431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 242
Target Start/End: Original strand, 21133051 - 21133125
Alignment:
| Q |
169 |
caggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||| |||||||||||| ||||||||||||||||||| ||| | ||||||| ||||||||||||| |||| |
|
|
| T |
21133051 |
caggggccggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctagccactagtctac |
21133125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 170
Target Start/End: Original strand, 22487878 - 22487920
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22487878 |
gtgagtttagctcagttggtagggatattgcattttatatgca |
22487920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 1588761 - 1588842
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| ||||| |||||| ||||| | ||||| |||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
1588761 |
tccctgtgagcatagcttagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccactt |
1588842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 150 - 242
Target Start/End: Original strand, 10761844 - 10761937
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||| || |||| |||||||||| |||||| |||||||||||| ||| || |||||| |||||||||||||||||| |
|
|
| T |
10761844 |
ggatattgcatattatatttagaggccggagttcgaaccctagacacctcacttctccacaattaaattgtgtgagctctagccactaggctac |
10761937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 15042453 - 15042385
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
15042453 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
15042385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #217
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 203
Target Start/End: Original strand, 17467288 - 17467352
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
17467288 |
ctcagttggtagggatatacattattatatgcaggggccg-ggttcgaaccccggacaccccactt |
17467352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #218
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 139 - 208
Target Start/End: Complemental strand, 24790380 - 24790311
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| | | ||||||||||| ||||||||||||| |||| |
|
|
| T |
24790380 |
tcagttggtagggatattacatattatatgtaggggttggggttcgaaccctggacaccccacttttcca |
24790311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #219
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 141 - 214
Target Start/End: Original strand, 34760983 - 34761056
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||| |||||| ||||||||||||||| ||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
34760983 |
agttagtagagatatttcatattatatgcagggaccggagttcgaaccccggacaccccacttcaccatattta |
34761056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #220
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 214
Target Start/End: Complemental strand, 34812557 - 34812508
Alignment:
| Q |
165 |
tatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| || | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34812557 |
tatgcaggggctggggttcgaaccccggacaccccacttctccacattta |
34812508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #221
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 242
Target Start/End: Original strand, 37669703 - 37669804
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||||||||||||||| |||||||||| || | ||||||||||| ||||| ||||||||||||| ||| | ||||| | |||||| || |||||| |
|
|
| T |
37669703 |
gttggtagggatattgcattttatatgcagtggctggagttcgaaccccagacactccacttctccacaattaaattgtgtcagctctagtcattaggct |
37669802 |
T |
 |
| Q |
241 |
ac |
242 |
Q |
| |
|
|| |
|
|
| T |
37669803 |
ac |
37669804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #222
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 195
Target Start/End: Original strand, 37838586 - 37838647
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
37838586 |
ttagctcaaatggtagggatattgcatattatatgcaggggccagagttcgaaccccggaca |
37838647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #223
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 42023415 - 42023499
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||||||||||||||| | |||||||| | |||||||| | |||||| ||||||| |||| |||||||||||||||||| |
|
|
| T |
42023415 |
tgagcttagctcagttggtagg-acattgcataatttatgcaggggtagaggtttgaacccctgacatcccacttctccacattta |
42023499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #224
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 120 - 168
Target Start/End: Original strand, 14245141 - 14245189
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
14245141 |
ttatccccgtgagtttaggtaagttggtagggatattgcatattatatg |
14245189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #225
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 212
Target Start/End: Complemental strand, 32191943 - 32191859
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||||||||| |||||| ||||||| | |||||||| |||| ||| | | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
32191943 |
gtgagtttagttcagtttgtagggacaatgcatattttatgtaggggttggagttcgaaccccagacaccccacttctccacatt |
32191859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #226
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 242
Target Start/End: Complemental strand, 38107505 - 38107425
Alignment:
| Q |
164 |
atatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtga-actctagccactaggctac |
242 |
Q |
| |
|
||||||||| |||| |||||||||||| ||||||||||||||||||| ||| | |||| || |||||||||||||||||| |
|
|
| T |
38107505 |
atatgcaggggccggggttcgaaccccagacaccccacttctccacaattaaattgtgcgaggctctagccactaggctac |
38107425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #227
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 39974844 - 39974923
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| | ||| |||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
39974844 |
gtgagcttagctcagttggtaggaatattgcataatttatacagggaccgaggttcgaa---cggacaccccacttttccaca |
39974923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #228
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 8034562 - 8034605
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
8034562 |
tattatatgcaggagccggggttcgaaccccgaacaccccactt |
8034605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #229
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 17980314 - 17980357
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
17980314 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
17980357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #230
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 36358970 - 36359084
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
||||| ||| || ||||||||||||||||||||| | ||||| || || | | |||||||||| |||||| ||||||| ||| ||| | |||||||| || |
|
|
| T |
36358970 |
gtgagcttaacttagttggtagggatattgcataatttatgc-ggggcagggattcgaacccctgacaccgcacttcttcacctttaaaatgtgtgagct |
36359068 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
36359069 |
ctagccactagactac |
36359084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #231
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 41454922 - 41454847
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
41454922 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccactt |
41454847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #232
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 191
Target Start/End: Complemental strand, 45190626 - 45190563
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
191 |
Q |
| |
|
||||| ||| ||| |||| ||| |||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
45190626 |
gtgagcttaactcggttgatagagatattgcatattatatgcaggggctgaggttcgaaccccg |
45190563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #233
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 236
Target Start/End: Complemental strand, 2626081 - 2626023
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| | ||||||| |||||||||||| |
|
|
| T |
2626081 |
ggttcgaactccggacaccccacttctccacaattaaattgtgtgagctctagccacta |
2626023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #234
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 11297060 - 11296978
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| ||||||| | ||| || | |||||||| | ||||| ||||||| ||||| |
|
|
| T |
11297060 |
gtgagcttagttcagttggtagggatattgcattttatatgtatgagtcgggattcgaacctcagacactccacttccccaca |
11296978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #235
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 120 - 210
Target Start/End: Complemental strand, 11962619 - 11962529
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||| |||||||||||| ||| ||||||| || || ||||||| | | ||||||||||||| |||| ||||||||||||| |
|
|
| T |
11962619 |
ttatccccgtgagcttagctcagttgatagagatattgtattttgtatgcagtggtgggggttcgaaccccgaacactccacttctccaca |
11962529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #236
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 241
Target Start/End: Complemental strand, 12273744 - 12273630
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||||||||||| |||| | | ||||||||||| |||||| || || ||||| ||||| ||||||| | |
|
|
| T |
12273744 |
gtgagcttagctcagttagtaggaatattgcatattatatacagggactggggttcgaaccctggacacttcatttatccacaatttaattgtgtgagtt |
12273645 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
12273644 |
ctaaccactaggcta |
12273630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #237
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 135 - 200
Target Start/End: Complemental strand, 17987537 - 17987472
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
17987537 |
tagctcagttggtagg-ataatgcattattatatgcaggggccggagttcgaaccccggacacccca |
17987472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #238
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 234
Target Start/End: Complemental strand, 20164287 - 20164169
Alignment:
| Q |
116 |
gaatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat |
215 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||| |||||| ||||||||||||||| | | |||||||| | ||| | |||| ||||||||||| |
|
|
| T |
20164287 |
gaatttatcgttgtgagcttaactcagttggtagagatattacatattatatgcagggatcaatgttcgaactttgaacatctcactactccacatttaa |
20164188 |
T |
 |
| Q |
216 |
atgtgtgaactctagccac |
234 |
Q |
| |
|
|| ||||||||||| |||| |
|
|
| T |
20164187 |
atttgtgaactctaaccac |
20164169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #239
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 39164982 - 39165055
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||||||||||| || |||||||| ||||||| | |||| ||||||||| ||||||||||||||| |
|
|
| T |
39164982 |
tgagcttagctcagttggtagagacattgcataacatatgcaagggccg-ggttcgaacaccggacaccccactt |
39165055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #240
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 130 - 208
Target Start/End: Original strand, 40249203 - 40249280
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||||||||| ||| | || ||| ||||||||||||| ||||||||||| |
|
|
| T |
40249203 |
gagttttgctcagtcggtagggatattacatattatatgtagggtctga-gtttgaaccccggacacaccacttctcca |
40249280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #241
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 166
Target Start/End: Original strand, 42457136 - 42457174
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattata |
166 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42457136 |
gtgagtttatctcagttggtagggatattgcatattata |
42457174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #242
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 10292358 - 10292427
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| || ||| |||||||| |||||||||||||| |
|
|
| T |
10292358 |
tagctcagttggcagggacaatgcattattatatgcaggggctgagattcgaacctcggacaccccactt |
10292427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #243
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 118 - 242
Target Start/End: Original strand, 11491795 - 11491915
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata- |
216 |
Q |
| |
|
|||||| |||||||| ||| ||| |||| |||||||||||||| |||| || |||| || ||||||||||||| ||||||||||||| ||| | |
|
|
| T |
11491795 |
atttattcctgtgagcttaactcggttgatagggatattgcattttat-----ggggccggattttgaaccccggacactccacttctccacaattaaat |
11491889 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||||||| |||| |
|
|
| T |
11491890 |
tgtgtgagctctagccactagactac |
11491915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #244
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 242
Target Start/End: Complemental strand, 11900496 - 11900395
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||| |||||||||| |||||||||||||| | | | |||||| |||||||| ||||| |||||||| ||| | |||||| | ||||| ||||||||| |
|
|
| T |
11900496 |
gttggaagggatattgtatattatatgcaggtgttgggattcgaatcccggacatcccacctctccacaattaaattgtgtgcattctagtcactaggct |
11900397 |
T |
 |
| Q |
241 |
ac |
242 |
Q |
| |
|
|| |
|
|
| T |
11900396 |
ac |
11900395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #245
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 13555842 - 13555777
Alignment:
| Q |
145 |
ggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| ||||||||||| ||||||| |||| |||||||| |
|
|
| T |
13555842 |
ggtagggatattgcattttatatgtcggagctgaggttcgaacaccggacattccacatctccaca |
13555777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #246
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 197
Target Start/End: Original strand, 13575289 - 13575358
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| ||||||| | |||||||||||||| ||| |||| |
|
|
| T |
13575289 |
gtgagtttagctcagttggtagggacaatgcataacatatgcaagttccgaggttcgaacctcggccacc |
13575358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #247
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 171
Target Start/End: Original strand, 13591816 - 13591865
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
13591816 |
atccccgtgagtttaactcagttggtagggatatcgcattttatatgcag |
13591865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #248
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 210
Target Start/End: Original strand, 13670723 - 13670788
Alignment:
| Q |
145 |
ggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| ||||||||||| ||||||| |||| |||||||| |
|
|
| T |
13670723 |
ggtagggatattgcattttatatgtcggagctgaggttcgaacaccggacattccacatctccaca |
13670788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #249
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 17855686 - 17855735
Alignment:
| Q |
165 |
tatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||| | |||||||| |
|
|
| T |
17855686 |
tatgcaggggccggggttcgaaccccggacaccccacttattcacattta |
17855735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #250
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 196
Target Start/End: Original strand, 18942917 - 18942986
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||| |||||||| | ||| | ||| |||||||||||| |
|
|
| T |
18942917 |
tgtgagcttagctcagttggtagggataatgcataatatatgcatggtccgggtttcaaaccccggacac |
18942986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #251
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 25689476 - 25689408
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
25689476 |
tagctcagttggtagg-acactgcattattatatgtaggggccgaggttcgaaccccggacaccctactt |
25689408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #252
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 43847709 - 43847777
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
43847709 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaaccccgaacaccccactt |
43847777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #253
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 12548056 - 12548112
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| || | || |||||||||||| |
|
|
| T |
12548056 |
ttagctcagttggtaggaatattacatattatatgctggggtcggggttcgaacccc |
12548112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #254
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 24517304 - 24517360
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
||||||||||||||||||| ||||||| | ||||||||||| | |||||||||||| |
|
|
| T |
24517304 |
ttagctcagttggtagggacattgcatgatttatgcaggagcaggggttcgaacccc |
24517360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #255
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 170
Target Start/End: Original strand, 28628662 - 28628710
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28628662 |
atccccgtgagcttagctcagttggtacggatattacatattatatgca |
28628710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #256
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 168
Target Start/End: Complemental strand, 38337094 - 38337054
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38337094 |
gtgaatttagttcagttggtagggatattgcatattatatg |
38337054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #257
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 39169539 - 39169603
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccaca-tttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
39169539 |
ggttcgaaccccagacactcaacttctccacaatttaattgtgtgagctctagccactaggctac |
39169603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #258
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 242
Target Start/End: Complemental strand, 39709242 - 39709142
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||||| |||||||||||| |||||||| || | |||||||||| || |||| ||| ||||||||| ||| | ||||||| |||||| ||||| |||| |
|
|
| T |
39709242 |
ttggtagagatattgcatatcatatgcagcagttggggttcgaacctcgtacactccagttctccacaattaaattgtgtgagctctagtcactatgcta |
39709143 |
T |
 |
| Q |
242 |
c |
242 |
Q |
| |
|
| |
|
|
| T |
39709142 |
c |
39709142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #259
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 236
Target Start/End: Complemental strand, 1286609 - 1286511
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||| | |||||||| |||| |||| |||||| | |||| ||| | | ||||| |||||||||||| |
|
|
| T |
1286609 |
ctcaattggtagggatattgcatattatatgca-gagttggggttcgaatcccgaacactccacttttgcacaattaaattatgtgagctctagccacta |
1286511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #260
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 3227072 - 3227022
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||| ||||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
3227072 |
tatccccgtgagattagttcagttggtagg-atattgcatattatatgcagg |
3227022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #261
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 210
Target Start/End: Original strand, 3828371 - 3828402
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3828371 |
ggttcgaaccccggacaccccacttctccaca |
3828402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #262
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 233
Target Start/End: Original strand, 4444294 - 4444367
Alignment:
| Q |
158 |
catattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||| |||||||||| ||||||||||||| | |||||||| |||||||| |
|
|
| T |
4444294 |
catactatatgcag-agccgagattcgaactccggacaccc-acttctccacattaaaatgtgtgaggtctagcca |
4444367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #263
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 220
Target Start/End: Complemental strand, 6851092 - 6851001
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||| ||| |||| ||||||| || |||||||| | |||||||| | | | ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
6851092 |
tgagcttaactcaattggtagagacattgcataatttatgcaggggtagggattcgaaccccggacaccttacttctccacatttaaatgtg |
6851001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #264
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 214
Target Start/End: Original strand, 7678954 - 7679028
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| || ||| |||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
7678954 |
tcagttggtaaggatattgtatattatatgcatga-tcgaagttcgaacttcggacactccatttctccacattta |
7679028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #265
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 203
Target Start/End: Original strand, 10970263 - 10970341
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||| |||||||||||| || | ||||| ||||||| ||||||||||| |
|
|
| T |
10970263 |
cctgtgagcatagctcagttggtagg-ataatgcattattatatgcaggggctggggttcaaaccccgaacaccccactt |
10970341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #266
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 190
Target Start/End: Original strand, 12736191 - 12736254
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
|||||| ||||||||||||||| ||| || ||||||||||||||| | || |||||||||||| |
|
|
| T |
12736191 |
tgtgagcttagctcagttggtaaggacgttacatattatatgcaggggtcggggttcgaacccc |
12736254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #267
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 199
Target Start/End: Original strand, 28378844 - 28378883
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacacccc |
199 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
28378844 |
tattatatgcaggggctgaggttcgaaccccggacacccc |
28378883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #268
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 167
Target Start/End: Original strand, 28460204 - 28460243
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
28460204 |
gtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #269
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 30942662 - 30942619
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
30942662 |
tattatatgcaggggccggggttcgaaccccgaacaccccactt |
30942619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #270
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 214
Target Start/End: Complemental strand, 39712335 - 39712272
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||||||||||| ||| | || ||||||||||||| | |||||||||||||||||| |
|
|
| T |
39712335 |
gatattgcatattatatgtaggggtcggaattcgaaccccggatatcccacttctccacattta |
39712272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #271
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 172
Target Start/End: Complemental strand, 2381740 - 2381698
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
2381740 |
gagtttagctcagttggcagagatattgcattttatatgcagg |
2381698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #272
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 168
Target Start/End: Original strand, 2590146 - 2590192
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||| ||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
2590146 |
atccccgtgagcttagctcaattagtagggatattgcatattatatg |
2590192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #273
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 5184985 - 5184907
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| |||||||||||||||| || | ||||||||||||| || | ||||||||||| ||||||||||||| |
|
|
| T |
5184985 |
cctgtgagcatagctcagttggtaggacaatggattattatatgcaggggctggggttcgaaccctggacaccccactt |
5184907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #274
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 210
Target Start/End: Complemental strand, 18144705 - 18144675
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18144705 |
gttcgaaccccggacaccccacttctccaca |
18144675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #275
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 239
Target Start/End: Original strand, 18412564 - 18412670
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||||||| | || |||||||| || |||| ||| |||| |||||||| | ||||| |||| || |
|
|
| T |
18412564 |
tttagctcagttggtagggacattgcataatttatgcaggggtcggagttcgaacatcgtacactccatttcttcacatttaattatgtgagttctaacc |
18412663 |
T |
 |
| Q |
233 |
actaggc |
239 |
Q |
| |
|
||||||| |
|
|
| T |
18412664 |
actaggc |
18412670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #276
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 172
Target Start/End: Complemental strand, 19161956 - 19161919
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19161956 |
ttagctcagttggtagg-atattgcatattatatgcagg |
19161919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #277
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 172
Target Start/End: Complemental strand, 26467395 - 26467349
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||||||| || |||||||||| ||||||||| ||||||||||| |
|
|
| T |
26467395 |
ctgtgagtttaacttagttggtaggaatattgcattttatatgcagg |
26467349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #278
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Original strand, 37938495 - 37938537
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
37938495 |
gtgagtttagctcagttggtatggataatgcataatatatgca |
37938537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #279
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 198
Target Start/End: Original strand, 39104607 - 39104677
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccc |
198 |
Q |
| |
|
||||||||||||| |||||| |||||| |||| | ||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
39104607 |
tgagtttagctcatttggtaagggataatgcacaatatgtgcagcggccggggttcgaaccccggacaccc |
39104677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #280
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 171
Target Start/End: Complemental strand, 44260267 - 44260213
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
|||| |||||||| | |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44260267 |
aattcatccctgtaaacttagctcagttgatagagatattgcatattatatgcag |
44260213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #281
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 220
Target Start/End: Complemental strand, 45281346 - 45281307
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45281346 |
ggttcgaaccccggacacc--acttctccacatttatatgtg |
45281307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #282
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 197
Target Start/End: Original strand, 7553679 - 7553748
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||| |||||||| | || |||||| ||| ||||||||| |
|
|
| T |
7553679 |
gtgagtttaactcagttggtagggacaatgcataatatatgcaaggtccaaggttcaaactccggacacc |
7553748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #283
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 9524964 - 9525032
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| |||||||||||| ||||||| |||| |
|
|
| T |
9524964 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaaccccagacaccctactt |
9525032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #284
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 11710297 - 11710402
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| | | || | |||||| | |||| ||||||||||| ||||| ||||||| |||| |||||| |
|
|
| T |
11710297 |
ctcagttgttagggatattgcatattacatgcaggggactagatatgaaccctgaacacttcacttctccacaatttaattgtgtgagttctaaccacta |
11710396 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
11710397 |
ggctac |
11710402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #285
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 147 - 240
Target Start/End: Complemental strand, 11850708 - 11850615
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
|||||||||||||||||||||| | | | | ||||||||||||| || | |||||| || | | ||| ||||||| |||||||||||||||| |
|
|
| T |
11850708 |
tagggatattgcatattatatgtaagggtgggggttcgaaccccgcacgctccacttgtcgataattaattgtgtgagctctagccactaggct |
11850615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #286
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 24608571 - 24608503
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| |||||||||||| ||||||| |||| |
|
|
| T |
24608571 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaaccccagacaccctactt |
24608503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #287
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 199
Target Start/End: Original strand, 26657851 - 26657927
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgca-tattatatgcaggagccgaggttcgaaccccggacacccc |
199 |
Q |
| |
|
|||||||||| |||||||||||||||||| | |||| | ||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
26657851 |
tccctgtgagcatagctcagttggtagggaca-tgcattgttatatgcagggaccggggttcgaaccccagacacccc |
26657927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #288
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 168
Target Start/End: Original strand, 27146098 - 27146139
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
27146098 |
tgtgagtttcgctcagttggtaaggatattgcatactatatg |
27146139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #289
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 196
Target Start/End: Original strand, 30623288 - 30623361
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| | |||||| |||||||| | | | ||||||||||||| |||| |
|
|
| T |
30623288 |
tccctgtgagcttagctcagttggtaaggacaatgcataatatatgcaaggtctggggttcgaaccccgaacac |
30623361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #290
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 203
Target Start/End: Complemental strand, 34073323 - 34073259
Alignment:
| Q |
139 |
tcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||| ||||| |||||||| ||| | | |||||||||||||||||||||||||| |
|
|
| T |
34073323 |
tcagttggtagg-ataatgcattattatatgtaggggtcaaggttcgaaccccggacaccccactt |
34073259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #291
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 35301252 - 35301183
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| | || ||||||||| |||||||||| |||| |
|
|
| T |
35301252 |
tagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaactccggacaccctactt |
35301183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #292
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 36918495 - 36918604
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||| ||||||| ||||||||||| || | | |||||||| | ||||||| ||| ||||||| | ||| | ||||||| || |
|
|
| T |
36918495 |
gtgagcttaactcagttggtaaggatattacatattatatgtagaggtaggggttcgaatctcggacactccatttctccataattaaattgtgtgagct |
36918594 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
36918595 |
ctagccacta |
36918604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #293
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 208
Target Start/End: Original strand, 38818801 - 38818878
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||| |||||||| || |||| | |||| ||||||||||| |||| ||||||||| ||||| || ||||| ||||| |
|
|
| T |
38818801 |
agtttaactcagttgataaggatgtcgcattttatatgcaggggccggggttcgaactccggatactccactcctcca |
38818878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #294
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 39484458 - 39484390
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| |||||||| ||||||||||||||| |
|
|
| T |
39484458 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaatgccggacaccccactt |
39484390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #295
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 42801685 - 42801636
Alignment:
| Q |
159 |
atattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||||| ||| | || |||||||||| ||||||||||||||||||| |
|
|
| T |
42801685 |
atattatatgtaggggtcggggttcgaacctcggacaccccacttctcca |
42801636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #296
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 43508537 - 43508468
Alignment:
| Q |
135 |
tagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| || |||| | |||||| |||||| ||| |||| |||| |||||||||||||||||||| |
|
|
| T |
43508537 |
tagctcagttgataagggacaatgcataatatatgtaggggccggggtttgaaccccggacaccccactt |
43508468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #297
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 196
Target Start/End: Original strand, 1342726 - 1342794
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||| ||| |||||||||||| |||| || |||||||||| ||| | |||||||| ||||||| |||| |
|
|
| T |
1342726 |
gtgagcttaactcagttggtagagatactgtatattatatgtaggggtcgaggttcaaaccccgaacac |
1342794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #298
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 171
Target Start/End: Original strand, 6782901 - 6782933
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
6782901 |
tcagttggtagggatattgcattttatatgcag |
6782933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #299
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 7381884 - 7381828
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
7381884 |
ggttcgaatcccggacactccacttctccacaattatattgtgtgagttctagccac |
7381828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #300
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 242
Target Start/End: Complemental strand, 11236953 - 11236877
Alignment:
| Q |
166 |
atgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||| ||||||| |||| ||||| ||||||| | ||||| |||||||| ||||| |||||||||||| |
|
|
| T |
11236953 |
atgcaggggccggggttcgagccccaaacacctcacttcttaaaatttaaatgtgtgagctctatccactaggctac |
11236877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #301
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 206
Target Start/End: Complemental strand, 18424497 - 18424437
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||| |||||| |||||||||||||| || || ||||||||||||| || | ||||||||| |
|
|
| T |
18424497 |
gtagagatattacatattatatgcagtagtcggggttcgaaccccgaacgctccacttctc |
18424437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #302
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 31261002 - 31260898
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||| |||||| || |||||||| | |||||||| |||| | ||| ||||||| | ||| ||||||||||| |||| | ||||| ||||||||| ||| |
|
|
| T |
31261002 |
ctcagctggtagcgacattgcataatttatgcaggggccgggattcaaaccccgaatacctcacttctccacgtttaattatgtgagctctagccaatag |
31260903 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
31260902 |
actac |
31260898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #303
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 168
Target Start/End: Original strand, 37047018 - 37047058
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
37047018 |
gtgagtttatcacagttggtagagatattgcatattatatg |
37047058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #304
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 172
Target Start/End: Original strand, 40094888 - 40094932
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||| |||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
40094888 |
gtgagcttagctcagttgataaggatattgcattttatatgcagg |
40094932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #305
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 194
Target Start/End: Complemental strand, 42208536 - 42208464
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggac |
194 |
Q |
| |
|
||||| |||| |||||||||||||||| ||| | |||||| |||||||| | ||||||||| |||| ||||| |
|
|
| T |
42208536 |
atccccgtgaatttagctcagttggtaaggacaatgcataatatatgcaaggtccgaggttcaaacctcggac |
42208464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 290)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 118 - 242
Target Start/End: Original strand, 9125656 - 9125779
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat |
217 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9125656 |
atttatccccgtgagcttagctcagttggtagcgatattgcatattatatgcagg-gccggggttcgaaccccggacacctcacttctccacatttatat |
9125754 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
9125755 |
gtgtgagctctagccactaggctac |
9125779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 9835030 - 9835151
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
9835129 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
9835130 |
tgagctctagccactaggctac |
9835151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 12463753 - 12463874
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
12463753 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
12463852 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
12463853 |
tgagctctagccactaggctac |
12463874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 12891553 - 12891674
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12891553 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccacttctccacatttatatgtg |
12891652 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || || ||||||| |||| |
|
|
| T |
12891653 |
tgagctataaccactagactac |
12891674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 122 - 237
Target Start/End: Original strand, 42525397 - 42525513
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
42525496 |
T |
 |
| Q |
221 |
tgaactctagccactag |
237 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
42525497 |
tgagctctagccactag |
42525513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 8968752 - 8968867
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
8968752 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
8968851 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8968852 |
ctagccactaggctac |
8968867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 4417759 - 4417637
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
4417759 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
4417660 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||| ||||||| |
|
|
| T |
4417659 |
gtgagctctagccaccaggctac |
4417637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 11897242 - 11897366
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | | |
|
|
| T |
11897242 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaatt |
11897341 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||||||||||| |||| |
|
|
| T |
11897342 |
gtgtgagctctagccactagactac |
11897366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 25400427 - 25400319
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
25400427 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagcca |
25400328 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
25400327 |
ctaggctac |
25400319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 4745943 - 4745828
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
4745943 |
gtgagcttagctcagttggtagggatattgcatattatatgaaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
4745844 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4745843 |
ctagccactaggctac |
4745828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 35515515 - 35515630
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||| | ||||||| || |
|
|
| T |
35515515 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagct |
35515614 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35515615 |
ctagccactaggctac |
35515630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 41179876 - 41179761
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||| | |||| |
|
|
| T |
41179876 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacatttaaattgtg |
41179777 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
41179776 |
tgagctctagccacta |
41179761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 116 - 242
Target Start/End: Complemental strand, 17064937 - 17064811
Alignment:
| Q |
116 |
gaatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat |
215 |
Q |
| |
|
|||||||||| ||||| ||| |||| |||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17064937 |
gaatttatcctcgtgagcttaactcaattggtagggatattgcatattatatgcaggggccgacgtttgaaccccggacaccccacttctccacatttaa |
17064838 |
T |
 |
| Q |
216 |
atgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
17064837 |
ttgtgtgagttctagccactaggctac |
17064811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 17545246 - 17545124
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||| ||||| ||| |
|
|
| T |
17545246 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccataatttaattgt |
17545147 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
17545146 |
gtgagctctagccactaggctac |
17545124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 27765253 - 27765375
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||||||| ||| | ||| |
|
|
| T |
27765253 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaattgt |
27765352 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
27765353 |
gtgagctctagccactaggctac |
27765375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 6518849 - 6518732
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
6518849 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtg |
6518750 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
6518749 |
tgagctctagccactagg |
6518732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 13622022 - 13621897
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | | |
|
|
| T |
13622022 |
tttatccccgtgagcttagctcagttggtagggatatcgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaatt |
13621923 |
T |
 |
| Q |
218 |
gtgtga-actctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
13621922 |
gtgtgaggctctagccactaggctac |
13621897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 32505685 - 32505806
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
32505685 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
32505784 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| ||||||| |
|
|
| T |
32505785 |
tgagctctagccatcaggctac |
32505806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 8241045 - 8241168
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatg |
218 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||| | | || ||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
8241045 |
ttatccccatgagcttagctcagttggtagggatattgcatattatatgcaagggtcggggttcgaaccccggacaccccacttctccacatttaaaatg |
8241144 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||| |||||||||||| |
|
|
| T |
8241145 |
tgtgagctctaaccactaggctac |
8241168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 11774533 - 11774411
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
11774533 |
tatccccgtgaccttagctcagtttgtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
11774434 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||| ||||||||| |
|
|
| T |
11774433 |
gtgagctctagccgctaggctac |
11774411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 43580871 - 43580996
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| ||| | |
|
|
| T |
43580871 |
aatttatccc-gtgaacttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaa |
43580969 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||||||| |||| |
|
|
| T |
43580970 |
ttgtgtgagctctagccactagactac |
43580996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 21918049 - 21918170
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||| ||||||||||||| ||| | |||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccctggacactccacttctccacaattaaattgtg |
21918148 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||| ||||||||||| |
|
|
| T |
21918149 |
tgagctctagtcactaggctac |
21918170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 27798617 - 27798738
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| | ||||||||||| ||| | ||| |
|
|
| T |
27798617 |
tatccctgtgagcatagctcagttggtagggatattgcatattatatgcaagagccagggttcgaaccccggacactctacttctccacaattaaattgt |
27798716 |
T |
 |
| Q |
220 |
gtgaactctagccactaggcta |
241 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
27798717 |
gtgagctctagccactaggcta |
27798738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 36888468 - 36888347
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
36888468 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtg |
36888369 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| ||||| |
|
|
| T |
36888368 |
tgagctctagccactaagctac |
36888347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 5966826 - 5966945
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| || ||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat-tgt |
5966924 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |||| |
|
|
| T |
5966925 |
gagttctagccactagactac |
5966945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 39886288 - 39886164
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||| ||||||||||||| ||| | | |
|
|
| T |
39886288 |
tttatccccgtgagcatagctcagttggtagggatattgcatattatatgtaggagctggggttcgaaccccggacactccacttctccacaattaaatt |
39886189 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||||||||||| |||| |
|
|
| T |
39886188 |
gtgtgagctctagccactagactac |
39886164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 124 - 242
Target Start/End: Complemental strand, 4238379 - 4238260
Alignment:
| Q |
124 |
ccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggac-accccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
4238379 |
ccctgtgagtttagttcagttggtatggatattgcatattatatgcaggggccggggttcgaaccccggacgcccccacttctccacatttaattgtgtg |
4238280 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| |||||| || |||||||| |
|
|
| T |
4238279 |
agctctagtcattaggctac |
4238260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 14641176 - 14641061
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| || || |
|
|
| T |
14641176 |
gtgagcttaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagct |
14641077 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14641076 |
ctagccactaggctac |
14641061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 25648159 - 25648036
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa-ccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||| ||||| ||||||||||||| ||| | || |
|
|
| T |
25648159 |
tatccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaacccccagacactccacttctccacaattaaattg |
25648060 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
25648059 |
tgtgagctctagccactaggctac |
25648036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 120 - 238
Target Start/End: Original strand, 42320312 - 42320431
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||| ||||||||||||| ||| | || |
|
|
| T |
42320312 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggagttcgaaccccgaacactccacttctccacaattaaattg |
42320411 |
T |
 |
| Q |
219 |
tgtgaactctagccactagg |
238 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
42320412 |
tgtgagctctagccactagg |
42320431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 16386807 - 16386693
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| || ||||||||||||| ||| | ||||||| ||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctc |
16386708 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
16386707 |
tagccactagactac |
16386693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 10404136 - 10404245
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||| ||| ||||||||| ||| | ||||||| |||||||| |
|
|
| T |
10404136 |
ttagctcagttggtaggaatattgcatattatatgcaggagtcggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagcc |
10404235 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
10404236 |
actaggctac |
10404245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 24033086 - 24033195
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
24033086 |
ttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccggacacgccacttctccacaattaaattgtgtgagctctagcc |
24033185 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
| |||||||| |
|
|
| T |
24033186 |
attaggctac |
24033195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 128 - 237
Target Start/End: Complemental strand, 40276509 - 40276400
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| || ||| |||||||||||||| ||||||||||||||| ||| ||||||| || |
|
|
| T |
40276509 |
gtgagtttagctcagttggtaggaatattgcatattatatgcaggggctgagattcgaaccccggacgccccacttctccacaattaattgtgtgagttc |
40276410 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
40276409 |
tagccactag |
40276400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 120 - 236
Target Start/End: Original strand, 42916384 - 42916501
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| || ||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | || |
|
|
| T |
42916384 |
ttatccccgtgagcttagctcagttggtagggatattgtatgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattg |
42916483 |
T |
 |
| Q |
219 |
tgtgaactctagccacta |
236 |
Q |
| |
|
||||| || ||||||||| |
|
|
| T |
42916484 |
tgtgagctttagccacta |
42916501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 4067980 - 4068099
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| | |||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4067980 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgcagggggcgaggttcgaaccccggacaccccacttctccacatttaattgtgtg |
4068079 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||| | |||||| ||||| |
|
|
| T |
4068080 |
agctccaaccactacgctac |
4068099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 1743123 - 1743244
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||| ||| | ||| |
|
|
| T |
1743123 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccacttctctacaattaaattgt |
1743221 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| ||| ||||||| |
|
|
| T |
1743222 |
gtgagctctatacaccaggctac |
1743244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 6558797 - 6558919
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||| |||||||||||||||||||||||||||||| | || ||||||||| |||||||||| ||||||||||| ||| | ||| |
|
|
| T |
6558797 |
tatccccgtgagcttagctcaattggtagggatattgcatattatatgcaggggtcggggttcgaactccggacaccctacttctccacaattaaattgt |
6558896 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||| ||||||||||| |
|
|
| T |
6558897 |
gtgagctctagtcactaggctac |
6558919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 133 - 242
Target Start/End: Original strand, 28308242 - 28308352
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaactctagc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||| |||||||| || ||||| ||||||| ||||||| |
|
|
| T |
28308242 |
tttagctcagttggtagggatattgcatattatatgcaagagccgaggttctaaccccgaacactccacttctgcataatttaattgtgtgagctctagc |
28308341 |
T |
 |
| Q |
232 |
cactaggctac |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
28308342 |
cactaggctac |
28308352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 41156332 - 41156446
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtgaactc |
227 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||| ||| || |||||| ||| |
|
|
| T |
41156332 |
tgagcttagctcggttgatagggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccacaattaaatcgtgtgagctc |
41156431 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
41156432 |
tagtcactaggctac |
41156446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 15241393 - 15241514
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||| |||| ||||||||||||||||||||| | || |||||||||| ||||||||||||||||||||| ||| | |||| |
|
|
| T |
15241393 |
atccccgtgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaacctcggacaccccacttctccacaattaaattgtg |
15241492 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
15241493 |
tgagctctagccactagactac |
15241514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 21749450 - 21749330
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| || ||||||| ||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattatatgcaggagtcggtgttcgaa-cccggacactccacttctccacaattaaattgtg |
21749352 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
21749351 |
tgagctctagccactaggctac |
21749330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 126 - 242
Target Start/End: Original strand, 29154844 - 29154960
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaa |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| |
|
|
| T |
29154844 |
ctgtgagcttagctcagttggtagggatagtgcatattatatgtaggagccg-ggttcgaaccccggacactccacttctccacaattaaattgtgtgag |
29154942 |
T |
 |
| Q |
225 |
ctctagccactaggctac |
242 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
29154943 |
ttctagccactacgctac |
29154960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 32706319 - 32706440
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||| | |||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattatatggaggagccgggattcgaaccccggacactccacttctccacaattaaattgtg |
32706418 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||| || |||||||| |
|
|
| T |
32706419 |
tgagctctagtcattaggctac |
32706440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 40091474 - 40091595
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||| ||| | |||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaagagccgaggttcgaactccggacactccacttctccacaattaaattgtg |
40091573 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || ||| || |||||||| |
|
|
| T |
40091574 |
tgagctatagtcagtaggctac |
40091595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 2328589 - 2328677
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccaca |
2328677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 134 - 237
Target Start/End: Original strand, 18638607 - 18638711
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| |||| |||||||||||||||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
18638607 |
ttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagcc |
18638706 |
T |
 |
| Q |
233 |
actag |
237 |
Q |
| |
|
||||| |
|
|
| T |
18638707 |
actag |
18638711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 8478968 - 8478845
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||| || | |||||||||||| |||| |||||||| ||| ||||| || |
|
|
| T |
8478968 |
ttatccccgtgagtttagttcagttggtagggatattgcatattatatgcaggggctgtggttcgaaccccatacactccacttcttcacaatttaattg |
8478869 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||||| |||| |
|
|
| T |
8478868 |
tgtgagctctagccactagactac |
8478845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 122 - 240
Target Start/End: Complemental strand, 21962178 - 21962059
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||| |||||||||||| ||||||||| ||||||| |||||||||||||||||| |||||| |||||| ||| | |||| |
|
|
| T |
21962178 |
atccccgtgagcttaactcagttggcagggatattgcaaattatatgcgggagccggggttcgaaccccggacactccacttttccacaattaaattgtg |
21962079 |
T |
 |
| Q |
221 |
tgaactctagccactaggct |
240 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
21962078 |
tgagctctagccactaggct |
21962059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 25729515 - 25729392
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| |||| ||||||||||| | || |||||||||||| ||||| ||||||||||||| ||| | || |
|
|
| T |
25729515 |
ttatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaaccccagacactccacttctccacaattaaattg |
25729416 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||| |||||| |
|
|
| T |
25729415 |
tgtgagctctagccactgggctac |
25729392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 2848209 - 2848331
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| |||||||||||| ||| || ||||||||||||| |||| || ||||||||| ||| | ||| |
|
|
| T |
2848209 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcatgaggcggggttcgaaccccgcacacttcatttctccacaattaaattgt |
2848308 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
2848309 |
gtgagctctagccactaggctac |
2848331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 40361646 - 40361533
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | | | ||||||||| ||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
40361646 |
gtgagtttagctcagttggtagggatattgcatattatatgcaagggttggggttcgaactccggacaccccac-tctccacgtttaattgtgtgaactc |
40361548 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| ||||||| |||| |
|
|
| T |
40361547 |
taaccactagactac |
40361533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 1269240 - 1269119
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| ||||||||||||||||||||| ||| | |||| |
|
|
| T |
1269240 |
atccccgtgagcttagctcaattggtagagatattgcatattatatgcaggggccaaagttcgaacctcggacaccccacttctccacaattaaattgtg |
1269141 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| ||| |||||||| |
|
|
| T |
1269140 |
tgaactctgaccaataggctac |
1269119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 5900289 - 5900409
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
5900289 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggggccg-ggttcgaaccccggacattccacttctccacaatttaattgtg |
5900387 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| | |||||||||| |
|
|
| T |
5900388 |
tgagctctaactactaggctac |
5900409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 121 - 237
Target Start/End: Original strand, 6526046 - 6526163
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |||||||||||||| || | |||||||||||||| || ||||||||||||| ||| | ||| |
|
|
| T |
6526046 |
tatccccgtgagtttagctcagttggtagagatattggatattatatgcaggggctggagttcgaaccccggatactccacttctccacaattaaattgt |
6526145 |
T |
 |
| Q |
220 |
gtgaactctagccactag |
237 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
6526146 |
gtgagctctagccactag |
6526163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 128 - 237
Target Start/End: Complemental strand, 23292484 - 23292375
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||| | |||||||||| ||||||||||||||||||||| ||| |||||||| || |
|
|
| T |
23292484 |
gtgagcttagctcagttggtagggatattgcatgttatatgcagggtttggggttcgaacctcggacaccccacttctccacaattaattgtgtgaattc |
23292385 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
23292384 |
tagccactag |
23292375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 129 - 217
Target Start/End: Complemental strand, 17175117 - 17175029
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| |||| |||||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
17175117 |
tgagtttaactcagttggtagggatattgcatgttatatgcaggggccggggttcgaacctcggacactccacttctccacaattatat |
17175029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 20145625 - 20145517
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||| ||||||||||||||||||||| | |||||| | |||| |||||||||| ||||||||||||||||||||||||| ||||||| ||||||| | |
|
|
| T |
20145625 |
ttagcttagttggtagggatattgcataatttatgcaagggccggggttcgaacctcggacaccccacttctccacatttaattgtgtgagctctagcta |
20145526 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
20145525 |
ctagtctac |
20145517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 121 - 201
Target Start/End: Complemental strand, 39919167 - 39919087
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
39919167 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac |
39919087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 3198325 - 3198416
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||| |||||||||| | |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3198325 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcaggggttgaggttcgaaccccggacaccctacttctccacattta |
3198416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 11786127 - 11786012
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||| || |||||||||||||| |||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
11786127 |
gtgagcttaactcagttggtagggatattgcattttatatgcaggggctgaggttcgaaccccacacactccacttctccacaattaaattgtgtgagct |
11786028 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
11786027 |
ctagccactagactac |
11786012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 120 - 210
Target Start/End: Original strand, 16603393 - 16603483
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||| | |||||||||| ||||| | ||||||||||| |
|
|
| T |
16603393 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagaagccgggattcgaaccccagacactctacttctccaca |
16603483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 129 - 223
Target Start/End: Complemental strand, 36716924 - 36716830
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||||||||||||||| ||| |||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgcagggaccggggtttgaaccccggacactcaacttctccacatttatatgtgtga |
36716830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 36124393 - 36124517
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatat |
217 |
Q |
| |
|
|||||| | ||||| |||||||||||| |||| ||||||||||||||||||||| | || |||||||| ||||||||| |||||||||||| ||||| | |
|
|
| T |
36124393 |
tttatctccgtgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaatcccggacactccacttctccacaatttaact |
36124492 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||| ||||||| |||| |
|
|
| T |
36124493 |
gtgtgagctctaaccactagactac |
36124517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 11188749 - 11188634
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||||||| || | ||||| |||||| ||||| | |||||||||| ||||| ||||||| || |
|
|
| T |
11188749 |
gtgagcttagctcagttgataggaatattgcatattatatgcaggggctggggttcaaaccccagacactcaacttctccacaatttaattgtgtgagct |
11188650 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11188649 |
ctagccactaggctac |
11188634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 16891349 - 16891464
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| |||| | |||||||||| |||| |||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
16891349 |
gtgagcttagctcagttggtagggatattgcattttatatacaggggttgaggttcgaatcccgaacactccacttctccacaattaaattgtgtgagct |
16891448 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
16891449 |
ctagccactagactac |
16891464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 138 - 236
Target Start/End: Complemental strand, 18026885 - 18026786
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||| ||||||||||||||||||||| ||||||||||||||| ||| | ||||||| |||||||||||| |
|
|
| T |
18026885 |
ctcagttggtagagatattgtatattatatataggggccgaggttcgaaccccggactccccacttctccacaattaaattgtgtgagctctagccacta |
18026786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 132 - 237
Target Start/End: Original strand, 38097279 - 38097386
Alignment:
| Q |
132 |
gtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca-ccccacttctccacattt-atatgtgtgaactcta |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| || ||||||||||| | |||| |||||||||||||||||| | |||||||| ||||| |
|
|
| T |
38097279 |
gtttaactcagttggtatggatattgcatattatatgcaggggctgaggttcgaacatcagacacccccacttctccacatttaaaatgtgtgagctcta |
38097378 |
T |
 |
| Q |
230 |
gccactag |
237 |
Q |
| |
|
|||||||| |
|
|
| T |
38097379 |
gccactag |
38097386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 140 - 242
Target Start/End: Complemental strand, 41319506 - 41319403
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactagg |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | || ||||||||||||||||| ||||||||||||| ||| | ||||||| ||||||||||||| |
|
|
| T |
41319506 |
cagttggtagggatattgcattttatatgcaggggtcggagttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaga |
41319407 |
T |
 |
| Q |
239 |
ctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
41319406 |
ctac |
41319403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 546805 - 546919
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||| | || |||||||||| || ||| ||||||||| |||| ||| | ||||||| || |
|
|
| T |
546805 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcgaacatcccacttcttcacaattaaattgtgtgagct |
546904 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
546905 |
ctaaccactaggcta |
546919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 17891927 - 17891810
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt--atatgtgtgaa |
224 |
Q |
| |
|
||||| || |||||||||||||||| | ||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
17891927 |
gtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacattttaaaatgtgtgag |
17891828 |
T |
 |
| Q |
225 |
ctctagccactaggctac |
242 |
Q |
| |
|
||| |||||||| ||||| |
|
|
| T |
17891827 |
ctccagccactaagctac |
17891810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 24477828 - 24477942
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||||||||| | |||||||||| ||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
24477828 |
gtgagcttagctcagttggtagggacgttgcataatatatgcagggtatgtggttcgaacctcggacaccccacttctccacatttaattgtgtgagctc |
24477927 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
24477928 |
cagccactagtctac |
24477942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 177 - 242
Target Start/End: Complemental strand, 14805000 - 14804935
Alignment:
| Q |
177 |
gaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
14805000 |
gaggttcgaaccccggacaccccacttctccacatttaattgtgtgaactctagccactaagctac |
14804935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 22569317 - 22569197
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||| || || || ||||| |||||||| ||| ||| |||||||| ||||| |||| |
|
|
| T |
22569317 |
atccctgtgagcttagctcagttggtaggcatattgcatattatatacaaga-tcggggttcaaaccccgggcactccatttctccacaatttaattgtg |
22569219 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
22569218 |
tgagctctagccactaggctac |
22569197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 23938006 - 23937885
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| |||| |||||||||||||||||||||||| |||||||||| | ||||| |
|
|
| T |
23938006 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccactcctccacatttaaaatgtg |
23937907 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || |||||||||||||| |
|
|
| T |
23937906 |
tgagctacagccactaggctac |
23937885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 27241644 - 27241757
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| ||||||||||||||| | || |||| ||| ||||| |||||||||||||||||| | ||||| || ||| |
|
|
| T |
27241644 |
gtgagcttagctcagtttgtaggaatattacatattatatgcaggggtcggggtttaaactccggataccccacttctccacattaaaatgtgcgagctc |
27241743 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27241744 |
tagccactaggcta |
27241757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 144 - 237
Target Start/End: Complemental strand, 33018576 - 33018484
Alignment:
| Q |
144 |
tggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||| | |||||||| | || ||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
33018576 |
tggtagggatattgcataatttatgcagg-gtcggggttcgaacttcggacaccccacttctccacatttatatgtgtgagctccagccactag |
33018484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 122 - 194
Target Start/End: Original strand, 12767961 - 12768033
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggac |
194 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggagccggcgttcgaaccccggac |
12768033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 196
Target Start/End: Original strand, 39165020 - 39165088
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
39165020 |
gtgagtttagttcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccagacac |
39165088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 138 - 237
Target Start/End: Original strand, 41930118 - 41930218
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| || | |||||||||||| ||||||||||||||| ||| ||| | ||||||| |||||||||||| |
|
|
| T |
41930118 |
ctcagttgatagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctctacaattaaattgtgtgagctctagccacta |
41930217 |
T |
 |
| Q |
237 |
g |
237 |
Q |
| |
|
| |
|
|
| T |
41930218 |
g |
41930218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 137 - 242
Target Start/End: Complemental strand, 3821480 - 3821373
Alignment:
| Q |
137 |
gctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||| |||| |||||||| |||||| ||||||||||||||||||| | |||||||| ||| |||||| |
|
|
| T |
3821480 |
gctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaatcccggaaaccccacttctccacatttaaaatgtgtgagctccagccac |
3821381 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
3821380 |
taggctac |
3821373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 17666009 - 17666124
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||| | | ||||||||||||||| || |||| |||||||| ||| | ||||||| || |
|
|
| T |
17666009 |
gtgagcttagctcagttggtaggaatattgcatattatatgcaggggtcagggttcgaaccccggatactccacctctccacaattaaattgtgtgagct |
17666108 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
| |||||| ||||||| |
|
|
| T |
17666109 |
ccagccaccaggctac |
17666124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 234
Target Start/End: Original strand, 32550174 - 32550285
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||||||||| |||| ||||||||||| || |||||||| | |||||| | || | ||||||||||||| |||||||||| ||||||||||| |||||| |
|
|
| T |
32550174 |
tccctgtgagcttagttcagttggtagagacattgcataatttatgcatgggcaggggttcgaaccccgtacaccccactactccacatttaattgtgtg |
32550273 |
T |
 |
| Q |
223 |
aactctagccac |
234 |
Q |
| |
|
| |||||||||| |
|
|
| T |
32550274 |
agctctagccac |
32550285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 234
Target Start/End: Original strand, 831589 - 831698
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| ||||||| ||||||||||||||| ||||||||||||||| | || | |||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
831589 |
atccccgtgagcttagctctgttggtagggatatttcatattatatgcaggggtcgggattcg---cccggacaccccacttctccacatttaattgtgt |
831685 |
T |
 |
| Q |
222 |
gaactctagccac |
234 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
831686 |
gagttctagccac |
831698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 238
Target Start/End: Original strand, 988711 - 988828
Alignment:
| Q |
122 |
atccctgtgagtttagctcagtt-ggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
||||| ||||| ||| ||||||| ||||||||||||||||||||||||||||||| | |||||||||||| |||| ||||||||||||| ||| | ||| |
|
|
| T |
988711 |
atccccgtgagcttaactcagtttggtagggatattgcatattatatgcaggagctggggttcgaacccc-aacactccacttctccacaattaaattgt |
988809 |
T |
 |
| Q |
220 |
gtgaactctagccactagg |
238 |
Q |
| |
|
|||| |||| ||||||||| |
|
|
| T |
988810 |
gtgagctctggccactagg |
988828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 161 - 242
Target Start/End: Complemental strand, 2301605 - 2301523
Alignment:
| Q |
161 |
attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| ||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
2301605 |
attatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtgtgagctctagccactaggctac |
2301523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 3740966 - 3741072
Alignment:
| Q |
138 |
ctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccact |
235 |
Q |
| |
|
||||||||||||||| | || || ||||||||||| | || ||||||||||||||||||||||||||||||||||| | |||||||| ||| ||||||| |
|
|
| T |
3740966 |
ctcagttggtagggacaaatgtattttatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtgtgagctccagccact |
3741065 |
T |
 |
| Q |
236 |
aggctac |
242 |
Q |
| |
|
||||||| |
|
|
| T |
3741066 |
aggctac |
3741072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 127 - 232
Target Start/End: Original strand, 18928722 - 18928828
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | |||||||| | || ||||||||| |||||||| ||||| |||||||||| | ||||||| | |
|
|
| T |
18928722 |
tgtgagcttagctcagttggtagggatattgcataatttatgcaggggtcggtgttcgaaccacggacacctcacttttccacatttaaattgtgtgagc |
18928821 |
T |
 |
| Q |
226 |
tctagcc |
232 |
Q |
| |
|
||||||| |
|
|
| T |
18928822 |
tctagcc |
18928828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 212
Target Start/End: Original strand, 26912830 - 26912920
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
||||| ||||| ||| |||| |||||||||||||||||||||||||| ||| |||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattatatgtaggggccggggttcgaaccccaaacaccctacttctccacatt |
26912920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 35512032 - 35511914
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| ||| |||||||||||||||||| ||| |||||||| || |||| ||||||||||||||| || ||||||||| ||| ||| | | |
|
|
| T |
35512032 |
tttatccccgtgagcttaactcagttggtagggatatcacattttatatgctggggccggggttcgaaccccggaaactccacttctcgacaattaaatt |
35511933 |
T |
 |
| Q |
218 |
gtgtgaactctagccacta |
236 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
35511932 |
gtgtgagctctagccacta |
35511914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 145 - 237
Target Start/End: Original strand, 13958402 - 13958495
Alignment:
| Q |
145 |
ggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||| |||||||||||||||||||||| | || |||||||||||||||||| ||||||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
13958402 |
ggtagagatattgcatattatatgcaggggacggggttcgaaccccggacactccacttctccataatttaattgtgtgagctctagccactag |
13958495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 141 - 241
Target Start/End: Original strand, 16280262 - 16280363
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggc |
239 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||| | | |||||||||||||||||| ||||| ||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
16280262 |
agttggtagagatattgcattttatatgtaggggttggggttcgaaccccggacactccactcctccacatttaaattgtgtgagctctagccactaggc |
16280361 |
T |
 |
| Q |
240 |
ta |
241 |
Q |
| |
|
|| |
|
|
| T |
16280362 |
ta |
16280363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 141 - 237
Target Start/End: Original strand, 18050195 - 18050292
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| | || |||||||||||||||||| |||||||||||| ||||| ||||||| ||||||| ||||| |
|
|
| T |
18050195 |
agttggtagcgatattgcatattaaatgcaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagcaactag |
18050292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 131 - 236
Target Start/End: Complemental strand, 32389698 - 32389593
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctag |
230 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| || |||| || || |||||||||||||||| |||||| |||||||||| ||| |
|
|
| T |
32389698 |
agtttagctcagttggtagagatattgcatattatatgtaggagtcggagttcaaattccagacaccccacttctcctcatttaattgtgtgaactttag |
32389599 |
T |
 |
| Q |
231 |
ccacta |
236 |
Q |
| |
|
||||| |
|
|
| T |
32389598 |
tcacta |
32389593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 32423562 - 32423683
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||| ||||||||||| |||||||||||||| || | ||||| |||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
32423562 |
atccccgtgagcttaactcagttgttagggatattgtatattatatgcaggggctggggttcaaaccccagacactccacttctccacaatttaattgtg |
32423661 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |||| |
|
|
| T |
32423662 |
tgagttctagccactagactac |
32423683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 130 - 242
Target Start/End: Complemental strand, 34389677 - 34389565
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactct |
228 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||| |||| ||||||||||||||| || | ||||||||||| ||| | ||||||| ||| |
|
|
| T |
34389677 |
gagtttagctcagttggtaaagatattgcattttatatgcaggggccg-ggttcgaaccccggatactcaacttctccacaattaaattgtgtgagctca |
34389579 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
34389578 |
agccactagactac |
34389565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 141 - 242
Target Start/End: Original strand, 37182559 - 37182658
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| || |||||||| ||| ||||| ||||||||||||| ||| || ||||| |||| ||||||||||| |
|
|
| T |
37182559 |
agttggtagggatatcgcatattatatgcaggagtcggggttcgaaaccc-gacactccacttctccacaattaaat-tgtgagctcttgccactaggct |
37182656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 2362972 - 2363088
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa-ccccggacaccccacttctccac-atttatatgtgtgaac |
225 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||| | | |||||||| |||| ||||| |||||||| ||| ||||| ||||||| | |
|
|
| T |
2362972 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggggttggggttcgaacccccagacactccacttcttcacaatttaattgtgtgagc |
2363071 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
2363072 |
tctagccactagactac |
2363088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 3515541 - 3515418
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||||||||| | | ||||||||| |||||||| ||||||||||||| ||| | | |
|
|
| T |
3515541 |
tttatcctcgtgagtttagctcagttgacagggatattgcgtattatatgcaggggtc-aggttcgaattccggacactccacttctccacaattaaatt |
3515443 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||| ||||| ||||| |
|
|
| T |
3515442 |
gtgtgagctctagtcactatgctac |
3515418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 126 - 242
Target Start/End: Original strand, 18597410 - 18597526
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaac |
225 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| ||| | | ||||||| |||| |||||| ||||||||| || | |||||||| | |
|
|
| T |
18597410 |
ctgtgagtttagttcaattggtagggatattgcatattatatataggggttggggttcgacccccagacacctcacttctcctatttaaaatgtgtgagc |
18597509 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18597510 |
tctagccactaggctac |
18597526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 147 - 242
Target Start/End: Original strand, 29691379 - 29691475
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||| || |||| |||||||||| |||||||||||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
29691379 |
tagggatattgcatattatatttagaggccggagttcgaaccctggacaccccacttctccacaattaaattgtgtgagctctagccactaggctac |
29691475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 32226306 - 32226230
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||| ||||| | ||||||||||||||||||||| | || |||||||||| ||||||||||||||||||||| |
|
|
| T |
32226306 |
ttagctcagatggtatgaatattgcatattatatgcaggggtcggggttcgaacctcggacaccccacttctccaca |
32226230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 203
Target Start/End: Complemental strand, 41477434 - 41477350
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |||| ||||||||||| || | ||||||||||||| |||| |||||| |
|
|
| T |
41477434 |
tttatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggctggggttcgaaccccgaacactccactt |
41477350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 131 - 210
Target Start/End: Complemental strand, 10013223 - 10013144
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||| | ||||| |||||||| |||| |
|
|
| T |
10013223 |
agtttagctcagttgctagggatattatatattatatgtaggagccgaggttcgaacctcagacactccacttcttcaca |
10013144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 13876394 - 13876279
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
|||||||| || |||||||| ||| ||| ||||||| ||||||||||||| |||| |||||||||||||||||| ||| |||||||| ||||| |||| |
|
|
| T |
13876394 |
atccctgtcagcttagctcaattgatagagatattgtatattatatgcagcggccggggttcgaaccccggacactccatttctccacaatttaactgtg |
13876295 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| ||||| |||||| |
|
|
| T |
13876294 |
tgagctctaaccacta |
13876279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 18755989 - 18756104
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||| ||||| |||| ||||||||||||| || |||||||||||||||||| ||| ||||| ||| ||| | ||||||| | |
|
|
| T |
18755989 |
gtgagcttaactcagttggtagagatatcgcattttatatgcaggagtcggggttcgaaccccggacactccatttctctacaattaaattgtgtgagtt |
18756088 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
18756089 |
ctagccactagactac |
18756104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 127 - 206
Target Start/End: Complemental strand, 22229030 - 22228951
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| | || |||||||| |||||||| ||||||||| |
|
|
| T |
22229030 |
tgtgagtttagctcagttggtatggatattgcatgttatatgcaggggtcggagttcgaactccggacactccacttctc |
22228951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 121 - 236
Target Start/End: Complemental strand, 33736088 - 33735975
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| | ||| ||| ||||||||||||||||||||||||||||||||||| | || |||||||| ||| |||| |||| ||||||||| ||| |||| |
|
|
| T |
33736088 |
tatccccgggagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaa-ccctgaca-cccagttctccacaattaattgtg |
33735991 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
33735990 |
tgagctctagccacta |
33735975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 2474764 - 2474850
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| ||||||| ||| |||||||||| | ||||| |||| ||||||| ||||| |
|
|
| T |
2474764 |
gtgagtttagcttagttggtaaggatattgcatattacatgcaggggccaaggttcgaactctggacatcccatttctccatattta |
2474850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 6414071 - 6414180
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||| | || |||||||| || ||||| ||| ||||||||| ||| | ||||||| || |
|
|
| T |
6414071 |
gtgagcttaactcagttggtagggatattgcatattatatgcagg-gtcggggttcgaatcctggacattccatttctccacaattaaattgtgtgagct |
6414169 |
T |
 |
| Q |
227 |
ctagccactag |
237 |
Q |
| |
|
||||||||||| |
|
|
| T |
6414170 |
ctagccactag |
6414180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 16971618 - 16971737
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||| |||||||| ||||| | |||||||| |||||||||||||||||||||||| | || | |
|
|
| T |
16971618 |
tatccccgtgagcttagctcagttggtagagatattgtatattataggcaggtt--ggagttcgaactccggacaccccacttctccacattcaattgcg |
16971715 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
16971716 |
tgagctctatccactaggctac |
16971737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 39800097 - 39800011
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||||||||||||||||||| | |||||| | |||||||| || | || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
39800097 |
gtgagcttagctcagttggtagggacaatgcataatttatgcaggggcaggggctcgaacccctgacaccccacttctccacattta |
39800011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 41083604 - 41083491
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| | |||||||| | || |||||||| ||||||||||||||||||||| |||| | || || ||| |
|
|
| T |
41083604 |
gtgagtttagctcagttggtagagacattgcataatttatgcaggggtcggggttcgaa-tccggacaccccacttctccacgtttaattttgggagctc |
41083506 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
41083505 |
tagccactagactac |
41083491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 1463865 - 1463946
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| |||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
1463865 |
tccctgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
1463946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 10905197 - 10905088
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||| || |||||||| || ||||||||||| | || ||||||||||| |||||| ||||||||||| ||||| |||| || |||||||| |
|
|
| T |
10905197 |
ttagctcagttgataaggatattgtattttatatgcaggggtcggggttcgaaccctggacacttcacttctccacaatttaattgtgcgagctctagcc |
10905098 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
10905097 |
actaggctac |
10905088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 11146602 - 11146481
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||| || ||||||||||| ||||||| ||| | | ||||||||||||||||| ||||||||||||| || | |||| |
|
|
| T |
11146602 |
atccccgtgagcttagctcagttgataaggatattgcatgttatatgtaggggttggagttcgaaccccggacactccacttctccacagttcaattgtg |
11146503 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
11146502 |
tgagctctaaccactaggctac |
11146481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 12473986 - 12474098
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| ||||||||||||||||| | |||| ||| | |||||||| || || |||||||| ||| |||||||||||||||||||| || ||||||| |||| |
|
|
| T |
12473986 |
tgagcttagctcagttggtaggaacattgtataatttatgcaggggctgaagttcgaactccgaacaccccacttctccacattaat-tgtgtgagctct |
12474084 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
| ||||||| |||| |
|
|
| T |
12474085 |
aaccactagactac |
12474098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 15210794 - 15210907
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||||||| |||||||| |||| | ||||||||| |||||||| || |||| |||| | |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15210794 |
tgagtttaactcagttgataggaacgttgcatattctatgcagggatcggggtttgaactctggacaccccacttctccacatttaaatgtgtgaactct |
15210893 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
||||||| |||| |
|
|
| T |
15210894 |
gaccactagactac |
15210907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 27852745 - 27852624
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||| |||||| ||| |||| |||||||||||||||||| ||||||||| ||| ||| | | |
|
|
| T |
27852745 |
tttatccccgtgagtttagctcagttggtagggatatcacattttatat--agg-gccggggttcgaaccccggacactccacttctcgacaattaaatt |
27852649 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||| |||||| ||||| |
|
|
| T |
27852648 |
atgtgagctctacccactaagctac |
27852624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 28684957 - 28684852
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||| | |||||||||||| |||||||| ||||||||| | ||||| |||||||| ||||||||||| |
|
|
| T |
28684957 |
ctcagttgatagcgatattgcatattatatataggggtcgaggttcgaactccggacactccacttctctataatttaattgtgtgaattctagccacta |
28684858 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
28684857 |
ggctac |
28684852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 121 - 237
Target Start/End: Original strand, 32380691 - 32380808
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| || ||||||| ||||||| || |||||| ||| |||||||||||||| | |||||||| ||||||||| |||||||||| || ||| | | | |
|
|
| T |
32380691 |
tatccccgtaagtttagttcagttgataaggatatcacattttatatgcaggagctggggttcgaatcccggacactccacttctccgcaattaaattat |
32380790 |
T |
 |
| Q |
220 |
gtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32380791 |
gtgaactctagccactag |
32380808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 202
Target Start/End: Original strand, 37034810 - 37034883
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
|||| |||||||| ||||||||||||| |||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
37034810 |
tgagcttagctcaattggtagggatatcgcattttatatgcaggagccggagttcgaaccccggacactccact |
37034883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 208
Target Start/End: Original strand, 10241728 - 10241808
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||| | | ||||| |||||| ||||| ||||||||||| |
|
|
| T |
10241728 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggggttggggttcaaaccccagacactccacttctcca |
10241808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 240
Target Start/End: Original strand, 23155896 - 23156008
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||| |||| ||||| |||||||| | ||||||| |||||||||||||| ||| |||||| |||||||||||||| |||||||| ||| |
|
|
| T |
23155896 |
gtgagcttagctcaattggcagggacattgcataatttatgcagaggccgaggttcgaactccgaacacccaacttctccacattttaatgtgtgagctc |
23155995 |
T |
 |
| Q |
228 |
tagccactaggct |
240 |
Q |
| |
|
| ||||||||| |
|
|
| T |
23155996 |
caatcactaggct |
23156008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 122 - 206
Target Start/End: Complemental strand, 31074200 - 31074116
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||| ||| ||||||| |||||||| ||||||||||||| | || ||||||||| |
|
|
| T |
31074200 |
atccccgtgagcttaactcagttggtagggatattacattttatatgtaggagccggggttcgaaccccgaatactccacttctc |
31074116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 38696704 - 38696807
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| || | ||||||||||| |||||| |||||||| |||||||| |||||||| ||||| ||||||| |
|
|
| T |
38696704 |
ctcagttgatagggatattacatattatatgcaatggcgg-ggttcgaaccctggacactccacttcttcacatttaaatgtgtgagctctatccactag |
38696802 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
38696803 |
actac |
38696807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 122 - 214
Target Start/End: Original strand, 39147724 - 39147816
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||| ||||||||||||| ||||| | ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
39147724 |
atccccgtgagtttatctcagttggtaggaatactgcatattatatgttggagctggagttcgaaccccaaacaccccacttctccgcattta |
39147816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 242
Target Start/End: Original strand, 12355818 - 12355921
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| | || |||||||||||| |||| |||||| |||||| ||| | ||||||||||||||||| || | |
|
|
| T |
12355818 |
cagttggtagagatattgcattttatatgcaggggtcggagttcgaaccccgaacactccacttttccacaattaaattgtgtgaactctagccattaag |
12355917 |
T |
 |
| Q |
239 |
ctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
12355918 |
ctac |
12355921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 185
Target Start/End: Original strand, 18815345 - 18815408
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcga |
185 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcaggcgccggggttcga |
18815408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 35241399 - 35241513
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||| ||||||||||| |||||||||||||||||||||| | || |||||||| ||| ||||| |||||||||||| ||||| ||||||| | |
|
|
| T |
35241399 |
gtgagcttagttcagttggtagagatattgcatattatatgcaggggtcggggttcgaa-ccctgacactccacttctccacaatttaattgtgtgagtt |
35241497 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
35241498 |
ttagccactagactac |
35241513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 36270739 - 36270857
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||| |||||||| ||| | |||||||||| |||||| | | |||||||||||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
36270739 |
tccccgtgagcttaactcagttgatagaaacattgcatattttatgcaagggtcgaggttcgaaccccgaacatcccacttctccacatttaagtgtgtg |
36270838 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||| ||||||| |||| |
|
|
| T |
36270839 |
agctcta-ccactagtctac |
36270857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 242
Target Start/End: Complemental strand, 37553977 - 37553878
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| |||||||| | ||||||| |||||||||||||| || |||||||||||| |||||||||| ||||||| || |||||||||| |||| |
|
|
| T |
37553977 |
ttggcagggacattgcataatttatgcagaggccgaggttcgaactccagacaccccacttatccacatttaattgtgtgagctatagccactagactac |
37553878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 7143417 - 7143531
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||| ||| ||||||||||||||| |||||||||||| || | |||||||||||||||||| ||||||| |||| ||| ||||||| || |
|
|
| T |
7143417 |
gtgagcttagttcaattggtagggatattgtatattatatgcacaggctggagttcgaaccccggacacctcacttcttcacaattaattgtgtgagttc |
7143516 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
7143517 |
tagccattaggctac |
7143531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 8571823 - 8571905
Alignment:
| Q |
155 |
ttgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||| | |||||||| | || ||||||||||||| |||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
8571823 |
ttgcataatttatgcaggggtcggggttcgaaccccgaacaccctacttctccacatttaattgtgtgagctctagccactag |
8571905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 141 - 207
Target Start/End: Original strand, 9958593 - 9958659
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
9958593 |
agttgatagggatattgcatatcatatgcagggatcgaggttcgaaccccggacacctcacttctcc |
9958659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 177 - 242
Target Start/End: Original strand, 11795545 - 11795611
Alignment:
| Q |
177 |
gaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
11795545 |
gaggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctac |
11795611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 25472650 - 25472541
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa-ccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||| ||||| || |||||||||| ||||||||||||| | | | ||||||| | |
|
|
| T |
25472650 |
gtgagcttagctcagttggtagggatattgcatattatatgca-gagatcgggttcaaacccccggacactccacttctccacaataaaattgtgtgagc |
25472552 |
T |
 |
| Q |
226 |
tctagccacta |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
25472551 |
tctagccacta |
25472541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 32293539 - 32293457
Alignment:
| Q |
134 |
ttagctcagttggtagggat-attgcatattatatgcaggagccgaggttcgaaccccggacaccc-cacttctccacattta |
214 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||| |||| || |||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
32293539 |
ttagctcagttggtagggataaatgcattttatatgccggagtcggggttcgaacctcggacacccgcacttctccacattta |
32293457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 121 - 203
Target Start/End: Original strand, 34398453 - 34398535
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||||| ||| |||| ||||||| ||||| |||| ||||||||||||| || |||||||||||||||||| |||||| |
|
|
| T |
34398453 |
tatctctgtgagcttaactcaattggtagagatatcgcattttatatgcaggagtcggggttcgaaccccggacactccactt |
34398535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 35113029 - 35112947
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||| ||||||| |||||||||||||||||||||||||| | | ||||||||| |||||||| | ||||||||||| |
|
|
| T |
35113029 |
gtgagcttagttcagttgatagggatattgcatattatatgcaggggttggggttcgaactccggacactctacttctccaca |
35112947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 147 - 242
Target Start/End: Original strand, 36735893 - 36735990
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac--atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||| ||| | || |||||||||| ||||| |||||||||||| ||||| ||||||| |||||||||||||||||| |
|
|
| T |
36735893 |
tagggatattgcatattatatgtaggggtcggagttcgaaccctagacactccacttctccacaaatttaattgtgtgagctctagccactaggctac |
36735990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 238
Target Start/End: Complemental strand, 4418415 - 4418298
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||||| ||||| ||||||||||| || | |||||||||| |||||||| || |||||||||||| | ||||| |
|
|
| T |
4418415 |
tccccgtgagcttaactcagttggtagggataaatgcattttatatgcaggggctggggttcgaacctcggacacctcatttctccacatttaaaatgtg |
4418316 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| ||| | |||||||| |
|
|
| T |
4418315 |
tgagctccaaccactagg |
4418298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 128 - 197
Target Start/End: Original strand, 11017176 - 11017245
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||| | | |||||||||| |||||||||| |
|
|
| T |
11017176 |
gtgagtttagctcagttggtagggataatgcataatatatgcaaggtctgaggttcgaatcccggacacc |
11017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 231
Target Start/End: Complemental strand, 17345471 - 17345374
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagc |
231 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| ||| | | ||| |||||||| ||||||||||||| ||| |||| ||||| | ||||||| |
|
|
| T |
17345471 |
ttagctcagttggtagagatattacatattatatgcaagagtcaaagtttgaaccccgaacaccccacttcttcacgtttaattgtgtaagctctagc |
17345374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 139 - 235
Target Start/End: Complemental strand, 28758474 - 28758377
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc-ccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||||||||| |||||||| | |||||||||| || ||||| |||| ||||||||| |||||||||||||||| ||| ||| ||| ||||||| |
|
|
| T |
28758474 |
tcagttggtagggacattgcataatttatgcaggagtcggggttcaaacctccggacacctcacttctccacatttaattgtatgagctccagccact |
28758377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 172
Target Start/End: Original strand, 29045889 - 29045934
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29045889 |
tgtgagtttagttcagttggtagggatattgcatattatatgcagg |
29045934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 238
Target Start/End: Original strand, 40081875 - 40081992
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||| ||| ||||||||||| |||| ||||| || | | | || ||||||||||||| ||| | |||| |
|
|
| T |
40081875 |
atccccgtgagcttagctcagttggtagagatattacatcttatatgcaggggccggagttcgtactcggaatactccacttctccacaattaaattgtg |
40081974 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
40081975 |
tgagctctagccactagg |
40081992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 42718879 - 42718807
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||| | ||||||| ||| ||||||||| |
|
|
| T |
42718879 |
gctcagttggtagggatattgcatattatatgcaggagttggggttcgaa-ctcggacactccatttctccaca |
42718807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 237
Target Start/End: Complemental strand, 6734811 - 6734696
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||||| |||||| ||| |||| | |||||| |||| ||||||||||||||||||||| | ||||| |
|
|
| T |
6734811 |
tccctgtgaacttagctcagttggtagggacaaatgcataatatatgtaggggccgggtttcgaatcccg-acaccccacttctccacatttaaaatgtg |
6734713 |
T |
 |
| Q |
221 |
tgaactctagccactag |
237 |
Q |
| |
|
||| ||| ||||||||| |
|
|
| T |
6734712 |
tgagctccagccactag |
6734696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 142 - 210
Target Start/End: Complemental strand, 6735842 - 6735774
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| | || ||||||||||||| |||| ||||||||||||| |
|
|
| T |
6735842 |
gttggtagggatatttcattttatatgcaggggtcggggttcgaaccccgaacactccacttctccaca |
6735774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 19656033 - 19655925
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||| | ||| |||| ||| | |||||| | |||| |||||||||||||| |||||||||||||| ||||| ||||| | ||| ||||| |
|
|
| T |
19656033 |
ttagctcagttggcaaggacattgtataatttatgcacgggccggtgttcgaaccccggataccccacttctccatatttaattgtgtaagctcgagcca |
19655934 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
19655933 |
ctaggctac |
19655925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 19985509 - 19985585
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| || |||||||| |||||||| | ||||||||||| |
|
|
| T |
19985509 |
ttagctcagttggtagggatattgcataatatatgcagggatcggagttcgaactccggacactcaacttctccaca |
19985585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 33433980 - 33433916
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccc |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||| |||| ||||||||| |||||||||| |
|
|
| T |
33433980 |
ttagctcagttggtagaaatattgcatattatatacaggggccggggttcgaactccggacaccc |
33433916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 39234779 - 39234711
Alignment:
| Q |
155 |
ttgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||| |||||||| | || | ||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
39234779 |
ttgcatattttatgcaggggtcgggattcgaaccccggacaccccacttctccacgtttaaatgtgtga |
39234711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 42842943 - 42842835
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||||||||||| ||||||| ||||||||| | | |||| ||||| |||||| ||| |||||||||||||||| |||||||| ||| |
|
|
| T |
42842943 |
gtgagcttagctcagttggtagagatattgtatattatatataagggccggggttcaaaccccaaacatcccacttctccacattataatgtgtgagctc |
42842844 |
T |
 |
| Q |
228 |
tagccacta |
236 |
Q |
| |
|
||| ||||| |
|
|
| T |
42842843 |
tagtcacta |
42842835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 626810 - 626695
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||| ||||||| |||| |||||| |||||||||||||| ||||| ||| |||||||||||| ||| ||||||||| ||| | ||||||| || |
|
|
| T |
626810 |
gtgagtttaactcagttagtagagatattacatattatatgcagaagccggagtttgaaccccggacaatccatttctccacaattaaattgtgtgagct |
626711 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||| |||| |
|
|
| T |
626710 |
atagtcactagactac |
626695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 8750968 - 8750854
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||| | |||||||||||||||||||||||||||||||| || | |||||||| |||||||| ||||||||||| ||||| | || || || |
|
|
| T |
8750968 |
gtgagcttagttaagttggtagggatattgcatattatatgcagg-gctggggttcgaattccggacacttcacttctccacaatttaattatgagagct |
8750870 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
8750869 |
ctaaccactaggctac |
8750854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 233
Target Start/End: Complemental strand, 12677223 - 12677124
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||||||||||| || ||||||||| |||||||| ||| |||||||||||| || ||||| |||||||| |
|
|
| T |
12677223 |
ttagctcaattggtaggaatattacatattatatgcagggatcggggttcgaacaccggacacaccatatctccacatttaaatatgtgagttctagcca |
12677124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 234
Target Start/End: Complemental strand, 19891493 - 19891386
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||| ||||||||||| | | |||||||| |||||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
19891493 |
gtgagcttaactcagttggtaaggatattgcattttatatgcaggggttggggttcgaatcccggatactccacttctccacaattaaattgtgtgagct |
19891394 |
T |
 |
| Q |
227 |
ctagccac |
234 |
Q |
| |
|
||| |||| |
|
|
| T |
19891393 |
ctatccac |
19891386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 233
Target Start/End: Complemental strand, 20707839 - 20707748
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||| |||||||||| | | |||||||||||| ||||| |||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
20707839 |
ttggtagggatattgcatactatatgcaggggttggggttcgaaccccagacacttcacttctccacaattaaattgtgtgagctctagcca |
20707748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 160 - 242
Target Start/End: Original strand, 24132991 - 24133074
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| |||| |||||||||| ||| |||||||||||||||| ||| | ||||||| |||||| ||||||||||| |
|
|
| T |
24132991 |
tattatatgcaggggccggggttcgaaccttggataccccacttctccacaattaaattgtgtgagctctagtcactaggctac |
24133074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 214
Target Start/End: Original strand, 32623419 - 32623482
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
32623419 |
gatattgcatattatatacaggggtcgaggttcgaactccggacaccccatttctccacgttta |
32623482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 34208428 - 34208491
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
34208428 |
ggttcgaaccccagacaccccacttctccacaattaattgtgtgagttctagccactaggctac |
34208491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 203
Target Start/End: Original strand, 43227858 - 43227941
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| |||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
43227858 |
tatccctatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccactt |
43227941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 1469728 - 1469810
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| || | | |||| |||| | ||||||||||||||||||| |
|
|
| T |
1469728 |
gtgagtttagctcagttggtagagatattgcatattatatgtagaggttggggtttgaactctagacaccccacttctccaca |
1469810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 235
Target Start/End: Original strand, 7171768 - 7171838
Alignment:
| Q |
165 |
tatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||||||||||||||||| ||| ||||||| ||| ||||||| |
|
|
| T |
7171768 |
tatgcaggggccggggttcgaaccccagacaccccacttctccacaattaattgtgtgagctccagccact |
7171838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 242
Target Start/End: Original strand, 7443379 - 7443457
Alignment:
| Q |
165 |
tatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| || | ||||||||||| |||||||||||||||||||||||| |||||||| ||| | |||||||||||| |
|
|
| T |
7443379 |
tatgcaggggcaggggttcgaacccttgacaccccacttctccacatttataatgtgtgagctccaaccactaggctac |
7443457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 10758871 - 10758761
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc-cacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| ||| || | |||| |||||| ||||| ||||||||| |||| ||| | ||||||| | |
|
|
| T |
10758871 |
gtgagtttagctcaattggtaaagatattgcatattatatgtaggggctggggtttaaaccccagacactccacttctctcacaattaaattgtgtgagc |
10758772 |
T |
 |
| Q |
226 |
tctagccacta |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
10758771 |
tctagccacta |
10758761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 181 - 242
Target Start/End: Original strand, 16789126 - 16789188
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| | ||||||| ||||||||||||| |||| |
|
|
| T |
16789126 |
ttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactagactac |
16789188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 229
Target Start/End: Original strand, 3497430 - 3497504
Alignment:
| Q |
159 |
atattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat----atgtgtgaactcta |
229 |
Q |
| |
|
|||||||||||||| | || ||||||||||| |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
3497430 |
atattatatgcaggggtcggggttcgaaccctggacaccccacttctctacatttattaaaatgtgtgaactcta |
3497504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 4153560 - 4153665
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | | | | ||||||||| ||||||| | ||||||||||| ||| | ||||||| |||||||||||| |
|
|
| T |
4153560 |
ctcagttggtagggatattgcattttatatgtatgggttggggttcgaacttcggacactctacttctccacaattaaattgtgtgagctctagccacta |
4153659 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
| |||| |
|
|
| T |
4153660 |
gactac |
4153665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 148 - 242
Target Start/End: Complemental strand, 12053558 - 12053462
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc--tagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||| |||| ||| || | |||||||||||| |||||||||||||||||| ||| ||||||| ||| ||||||||||||||| |
|
|
| T |
12053558 |
agggacattgcatattttatgtaggggcaggggttcgaaccccagacaccccacttctccacgattaattgtgtgagctctatagccactaggctac |
12053462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 19647465 - 19647380
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||| |||||||| |||||| ||||||||| |||| |||| |||||| || ||||| |
|
|
| T |
19647465 |
tgagtttagcttagttggtatggacattgcataatatatgcataagccgaagttcgaacctcggataccctacttcttcatattta |
19647380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 226
Target Start/End: Original strand, 20430561 - 20430666
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| ||| ||| | ||||||| || | |||||||| |||||||||||| |||||||| |||| |||| |
|
|
| T |
20430561 |
tatctctgtgagtttagcttagttggtagggacattatataatttatgcagaggctggggttcgaaatccggacaccccatttctccacctttaattgtg |
20430660 |
T |
 |
| Q |
221 |
tgaact |
226 |
Q |
| |
|
|||||| |
|
|
| T |
20430661 |
tgaact |
20430666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 171
Target Start/End: Complemental strand, 29713449 - 29713400
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggatattgcctattatatgcag |
29713400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 30571164 - 30571201
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30571164 |
tagctcagttggtagggatattgcatattatatgcagg |
30571201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 36422492 - 36422613
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtg |
220 |
Q |
| |
|
|||| ||||| ||||||||||||||||| | | |||||| |||||||||| ||| ||||||||||| | || || | |||||| |||||| ||||||| |
|
|
| T |
36422492 |
tccccgtgagcttagctcagttggtaggaacaaatgcataatatatgcaggggccaaggttcgaacctcagatacactacttcttcacattaaatatgtg |
36422591 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
36422592 |
tgagctccagccactaggctac |
36422613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 143 - 236
Target Start/End: Complemental strand, 37684598 - 37684505
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||| ||||| |||||||| | ||||||| | |||||||||||| || |||||||||||| |||||||||| ||||||| || ||||||||| |
|
|
| T |
37684598 |
ttggcagggacattgcataatttatgcagaggtcgaggttcgaactccagacaccccacttatccacatttaattgtgtgagctatagccacta |
37684505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 6167223 - 6167330
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg--gacaccccacttctccacatttata-tgtgtgaactctagccac |
234 |
Q |
| |
|
||||||||| ||||| |||||||| | |||||||| || | ||||||||| | |||||| |||||||||||||||| | ||||||| |||||||||| |
|
|
| T |
6167223 |
ctcagttggcagggacattgcataatttatgcaggggcaggggttcgaacacatatgacacctcacttctccacatttaaaatgtgtgagctctagccac |
6167322 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
6167323 |
taggctac |
6167330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 214
Target Start/End: Complemental strand, 7545439 - 7545379
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||||| | | | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
7545439 |
attgcatattatatgcaggggtcaggattcgaatcccggacaccccacttctccacattta |
7545379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 122 - 237
Target Start/End: Complemental strand, 9688745 - 9688629
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||| |||| |||| |||||||||||||||||||| | || ||||||||||||| |||| ||||||| |||| ||| | |||| |
|
|
| T |
9688745 |
atccccgtgagcttagcttagtttgtagaaatattgcatattatatgcagaggtcggggttcgaaccccgaacactacacttcttcacaattaaattgtg |
9688646 |
T |
 |
| Q |
221 |
tgaactctagccactag |
237 |
Q |
| |
|
||| ||||| ||||||| |
|
|
| T |
9688645 |
tgagctctaaccactag |
9688629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 210
Target Start/End: Complemental strand, 13862349 - 13862277
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||| ||||||||||| || ||| || |||||||||||| |
|
|
| T |
13862349 |
ctcaattgatagggatattgcatattatatgcgggagtcgaggttcgaatcctggatacttcacttctccaca |
13862277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 33909002 - 33909094
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||| || | || |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33909002 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgtagaggtcggggttcgaaccccggacacccaacttctccacattta |
33909094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 126 - 198
Target Start/End: Complemental strand, 38642266 - 38642194
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccc |
198 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
38642266 |
ctgtgagtttagcttagttggtaggaatattacatattatatgcagggattggagttcgaaccccggacaccc |
38642194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 236
Target Start/End: Complemental strand, 6291933 - 6291831
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||| |||||||||| || ||||| | | || ||||||||||||||||| | |||||| |||| ||| | ||||||| |||||||| |
|
|
| T |
6291933 |
ttagctcagttggtaggcatattgcata-taaatgcaagggtcggtgttcgaaccccggacactctacttcttcacaattaaattgtgtgagctctagcc |
6291835 |
T |
 |
| Q |
233 |
acta |
236 |
Q |
| |
|
|||| |
|
|
| T |
6291834 |
acta |
6291831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 238
Target Start/End: Original strand, 10364355 - 10364414
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
10364355 |
ggttggaaccccggacactccacttctccacatttaaatgtgtgagctccggccactagg |
10364414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 10943748 - 10943791
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
10943748 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
10943791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 240
Target Start/End: Original strand, 11541745 - 11541804
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
11541745 |
ttcgaaccctggacacctcacttctccacatttaattgtgtgagctctagccattaggct |
11541804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 15715800 - 15715867
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||| | |||||| |||||||||| | |||||||||||||||||| |||| |||||| |||| |
|
|
| T |
15715800 |
ttggtagggacaatgcataatatatgcaggggtcgaggttcgaaccccggataccctacttcttcaca |
15715867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 242
Target Start/End: Original strand, 16745104 - 16745199
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||| ||| | || |||||||| || ||||||||||||||||||| ||| | | ||||| ||||||||| || ||||| |
|
|
| T |
16745104 |
agggatattgcatattatatgtaggggtcggagttcgaactccagacaccccacttctccacaattaaattatgtgagctctagccattaagctac |
16745199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 30641490 - 30641606
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagcc---gaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaa |
224 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||| |||| | | | |||||||||||||||||| | | ||||||||| ||| | ||||||| |
|
|
| T |
30641490 |
tgagtttagttcagttggtagggatattgcattttata-ccaggggtcgggggggttcgaaccccggacactctatttctccacaattaaattgtgtgag |
30641588 |
T |
 |
| Q |
225 |
ctctagccactaggctac |
242 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
30641589 |
ctctagccattaggctac |
30641606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 31250147 - 31250222
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
31250147 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccactt |
31250222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 32158509 - 32158397
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| |||||||| | | ||||| |||||||||||| |||| ||||||||||||| ||||||||||| | ||| ||||| | ||||| | |
|
|
| T |
32158509 |
gtgagcttagctcaattggtagg-acaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcac-cttataag-gtgaatt |
32158413 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32158412 |
ctagccactaggctac |
32158397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 235
Target Start/End: Complemental strand, 37636907 - 37636820
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
||||| |||||||| | |||||||| || ||||||| ||||||| | ||| |||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
37636907 |
agggacattgcataatttatgcaggggctgaggttcaaaccccgtatacctcacttctccacatttaattgtgtaagctctagccact |
37636820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 38503352 - 38503277
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
38503352 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccactt |
38503277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 125 - 171
Target Start/End: Original strand, 6119863 - 6119909
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6119863 |
cctgtgagcttagctcagttggaagggatattgcattttatatgcag |
6119909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 138 - 203
Target Start/End: Complemental strand, 6447566 - 6447500
Alignment:
| Q |
138 |
ctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| ||||| | ||||| |||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
6447566 |
ctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccactt |
6447500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 148 - 214
Target Start/End: Complemental strand, 16720653 - 16720587
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||| || ||||||||||||||| | || ||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
16720653 |
agggatgttacatattatatgcaggggtcggggttcaaacaccggacaccccacttcttcacattta |
16720587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 137 - 183
Target Start/End: Complemental strand, 19273260 - 19273214
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttc |
183 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
19273260 |
gctcagttggtagggatattgcatgttatatgcaggggccggggttc |
19273214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 25460797 - 25460732
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacattt--atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | |||||||| ||||| ||||||| |||| |
|
|
| T |
25460797 |
ggttcgaaccccgaacaccccacttctccacatttaaaaatgtgtgagctctaaccactagactac |
25460732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 170
Target Start/End: Complemental strand, 39028100 - 39028058
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39028100 |
gtgagattagctcatttggtagggatattgcatattatatgca |
39028058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 120 - 210
Target Start/End: Original strand, 39780801 - 39780890
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||| ||||||| ||| |||||||||||||| ||||||||| | |||| ||||||| ||||||||| |||||||| |||| |
|
|
| T |
39780801 |
ttatccccgtgagcgtagctcaattgctagggatattgcattttatatgcaagggccggagttcgaa-cccggacactccacttcttcaca |
39780890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 3535997 - 3535956
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3535997 |
ttatatacaggagccggggttcgaaccccggacaccccactt |
3535956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 4674904 - 4674835
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| ||||| | ||||| |||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
4674904 |
tagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccactt |
4674835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 240
Target Start/End: Original strand, 11535644 - 11535705
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||||||| ||||||| ||||||||| |||||| |
|
|
| T |
11535644 |
ggttcgaaccctggacacctcacttcttcacatttaattgtgtgagctctagccattaggct |
11535705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #206
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 242
Target Start/End: Original strand, 19119748 - 19119841
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| |||||||||| ||| | || |||| ||||| ||||||||||||||||| | ||||| ||||||| ||||||||||||||||| |
|
|
| T |
19119748 |
ggatattgtatattatatgaaggggacggggtttaaacccaagacaccccacttctccataattatattgtgtgagatctagccactaggctac |
19119841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #207
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 20719734 - 20719855
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||| || ||||||||||||||||||| ||||||| ||| | | ||||||||| || ||| |||||||||| || ||| | ||| |
|
|
| T |
20719734 |
tatccccgtgagcttagatctgttggtagggatattgcattttatatgtaggggtcagagttcgaacctcgaacattccacttctccgcaattaaattgt |
20719833 |
T |
 |
| Q |
220 |
gtgaactctagccactaggcta |
241 |
Q |
| |
|
|||| ||||| ||||||||||| |
|
|
| T |
20719834 |
gtgagctctaaccactaggcta |
20719855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #208
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 20735264 - 20735195
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||| ||| |||| |||||||| |||||||||||||||| |
|
|
| T |
20735264 |
tagctcagttggcagggacaatgcattattatatgtaggggccggggttcgaatcccggacaccccactt |
20735195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #209
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 235
Target Start/End: Original strand, 24456218 - 24456298
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||| | |||||||| | || ||||||||||||||||||| ||||||||||| ||| |||||||| ||| ||||||| |
|
|
| T |
24456218 |
attgcataatttatgcaggggtcggagttcgaaccccggacaccc-acttctccacagttaaatgtgtgagctccagccact |
24456298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #210
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 28871381 - 28871276
Alignment:
| Q |
139 |
tcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||| | || |||||||| ||||||||| |||||||||| ||||| | |||||||| || | |||||| |
|
|
| T |
28871381 |
tcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaatcccggacactccacttctccgcatttaaaatgtgtgagttccaaccacta |
28871282 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
28871281 |
ggctac |
28871276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #211
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 29841355 - 29841423
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
29841355 |
tagctcagttggtagg-acaatgcattattatatgcaagggccgagattcgaaccccggacaccccactt |
29841423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #212
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 33999073 - 33999178
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||| |||||| ||| ||||||| ||| | | |||||||||||||||||| ||| ||||||||| ||| | | ||||| ||||||||||| |
|
|
| T |
33999073 |
ctcagttggtaacgatattacattttatatgtaggggttggggttcgaaccccggacactccatttctccacagttaaattatgtgagttctagccacta |
33999172 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
33999173 |
ggctac |
33999178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #213
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 196
Target Start/End: Original strand, 1729485 - 1729553
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||| |||| | ||||| ||||| |||||||||||||||| ||| || |||||| ||||||||||||| |
|
|
| T |
1729485 |
gtgagcttagtttagttgatagggttattgcatattatatgtaggggctgaggtttgaaccccggacac |
1729553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #214
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 237
Target Start/End: Complemental strand, 11815666 - 11815566
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||| ||| |||| |||| || ||||||| | ||| | |||||||| ||||| ||||| |
|
|
| T |
11815666 |
ctcagttgaaagggatattgcatattatatgcaggagccgctgtttgaatcccgaacactccgtttctccaaaattaaattgtgtgaaatctagtcacta |
11815567 |
T |
 |
| Q |
237 |
g |
237 |
Q |
| |
|
| |
|
|
| T |
11815566 |
g |
11815566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #215
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 242
Target Start/End: Original strand, 14624294 - 14624394
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||| ||||| |||| ||||||| | |||||||||| ||| | ||||||| |||| |||| ||||||| |
|
|
| T |
14624294 |
ttggtagggatatcacattttatatgcaggggccggggttctaacctcggacacttcccttctccacaattaaattgtgtgagctctggccattaggcta |
14624393 |
T |
 |
| Q |
242 |
c |
242 |
Q |
| |
|
| |
|
|
| T |
14624394 |
c |
14624394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #216
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 18049688 - 18049580
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||| | ||| |||| | ||||||||||| ||| |||| | ||||||||||||| || |||| ||| |
|
|
| T |
18049688 |
gtgagcttagctcaattggtagggatattgcataatttatacaggggttgaggttcgaacaccgaacactaaaattctccacatttaattgcgtgagctc |
18049589 |
T |
 |
| Q |
228 |
tagccacta |
236 |
Q |
| |
|
|||||||| |
|
|
| T |
18049588 |
cagccacta |
18049580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #217
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 18477487 - 18477423
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| ||| | ||||||||||||| ||||||||||| |
|
|
| T |
18477487 |
ggttcgaaccctggacactccacttctccacaattaaattgtgtgaactctaatcactaggctac |
18477423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #218
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 162 - 242
Target Start/End: Original strand, 28537169 - 28537249
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||| | ||| || | | ||||| ||||||||||||||||| |
|
|
| T |
28537169 |
ttatatgcatgggccggggttcgaaccccggacaccccacttattcactttgaaaatggtgaattctagccactaggctac |
28537249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #219
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 29096396 - 29096291
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||| | |||| |||||||||||||||||||||||| | ||| ||||| | ||||| |||||||| |
|
|
| T |
29096396 |
tagctcagttggtagg-acaatgcattattatatgcaagggccggagttcgaaccccggacaccccacttattcac-cttataag-gtgaattctagcca |
29096300 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
29096299 |
ctaggctac |
29096291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #220
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 238
Target Start/End: Complemental strand, 30783758 - 30783670
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
||||||||||||||||||||| | || ||||||||| |||||||| |||||||||| ||||| ||||||| |||||| ||||||| |
|
|
| T |
30783758 |
gatattgcatattatatgcagaggtcggggttcgaactccggacacttcacttctccatgatttaattgtgtgagctctagtcactagg |
30783670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #221
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 206
Target Start/End: Original strand, 33802475 - 33802531
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||||||||| ||||||| | |||||| | |||||||||||||||| ||||||||| |
|
|
| T |
33802475 |
ggatattgcattttatatgtacgagccgggattcgaaccccggacactccacttctc |
33802531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #222
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 34729464 - 34729546
Alignment:
| Q |
123 |
tccctgtgagtttagctc--agttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| ||||||| | |||||| |||||| ||||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
| T |
34729464 |
tccctgtgagcttagctctcacttggtaagggataatgcatattatatgcaggggtcggggttcgaa-cccggacaccccactt |
34729546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #223
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 42455482 - 42455377
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| ||||||||||||||||| |||||| | ||| ||||| | ||||| |||||||| |
|
|
| T |
42455482 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggagttcgaaccccggacactccacttattcac-cttataag-gtgaattctagcca |
42455386 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
42455385 |
ctaggctac |
42455377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #224
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 186
Target Start/End: Original strand, 1670408 - 1670455
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaa |
186 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | || |||||||| |
|
|
| T |
1670408 |
tcagttggtagggatatggcatattatatgcaggggtcggggttcgaa |
1670455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #225
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 171
Target Start/End: Complemental strand, 3712141 - 3712090
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
||||||| || || |||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3712141 |
ttatccccgtaagcttagctcagttggtagagatattgcattttatatgcag |
3712090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #226
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 5908334 - 5908271
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||||| || |||||||| ||||| ||||||| |||||||||||||||||| |
|
|
| T |
5908334 |
ggttcgaacctcggacattccgcttctccatatttaattgtgtgagctctagccactaggctac |
5908271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #227
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 6614101 - 6614058
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
6614101 |
tattatatgcaggggccggggttcgaacctcggacaccccactt |
6614058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #228
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 8015867 - 8015910
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| ||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
8015867 |
tattacatgcaggggccggggttcgaaccccggacaccccactt |
8015910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #229
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 11313492 - 11313595
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||| || |||||||||| || |||||||||||||| || ||||| ||||||| ||| | |||||| | |
|
|
| T |
11313492 |
tcagttggtagggacattgcataaattatgtaggggctgaggttcgaatccttgacaccccacttctgcatatttaattgtgtgagctccaaccactaag |
11313591 |
T |
 |
| Q |
239 |
ctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
11313592 |
ctac |
11313595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #230
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 12637711 - 12637782
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||| |||||||||| |||||| |||| ||| |||||||| ||| |||| ||||||||||||| |
|
|
| T |
12637711 |
tcagttggtagagatattgcattttatatacagggaccggagttcgaactccgaacactccacttctccaca |
12637782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #231
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 214
Target Start/End: Complemental strand, 28822828 - 28822737
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||| ||| ||||||||||||||| |||| ||| | ||||||| || | ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
28822828 |
tccctgtgaacttatctcagttggtagggacattgtataatttatgcagagatcgggattcgaaccccgaacaccccacttctccatattta |
28822737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #232
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 146 - 240
Target Start/End: Complemental strand, 29646163 - 29646068
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacccc-acttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||| ||||||| | |||| ||| |||| ||||||||| || ||||||| ||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
29646163 |
gtagggacgttgcataatttatgtaggggccggagttcgaacctcgaacacccccacttctccacatttaattgtgtgagctccagccactaggct |
29646068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #233
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 214
Target Start/End: Complemental strand, 30209061 - 30208982
Alignment:
| Q |
136 |
agctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||| |||||||||| | ||||| ||||||||||| | || |||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
30209061 |
agctcacttggtagggacaaatgcattttatatgcaggggtcggggttcgaacctcgggcaccccacttctccatattta |
30208982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #234
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 241
Target Start/End: Original strand, 31556852 - 31556931
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||||||||| | || |||||||||||||||||||||||| | ||| || | | | ||||| |||||||||||||||| |
|
|
| T |
31556852 |
ttatatgcaggggtcggagttcgaaccccggacaccccacttattcaccttgaaaagggtgaattctagccactaggcta |
31556931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #235
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 202 - 237
Target Start/End: Complemental strand, 33432920 - 33432885
Alignment:
| Q |
202 |
ttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33432920 |
ttctccacatttatatgtgtgagctctagccactag |
33432885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #236
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 33800925 - 33800968
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
33800925 |
tattatatgcaggggccggggttcgaaccccagacaccccactt |
33800968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #237
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 191
Target Start/End: Original strand, 34436851 - 34436914
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
191 |
Q |
| |
|
||||| ||||||||||||||||||| | |||||| |||||||| | |||| ||||| ||||||| |
|
|
| T |
34436851 |
gtgagcttagctcagttggtagggacaatgcataatatatgcaagggccggggttcaaaccccg |
34436914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #238
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 36045197 - 36045154
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
36045197 |
tattatatgcaggggtcggggttcgaaccccggacaccccactt |
36045154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #239
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 143 - 214
Target Start/End: Complemental strand, 36564474 - 36564403
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| |||||| ||| ||||||| || |||| ||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
36564474 |
ttggtaggaatattgtataatatatgctggggccggagttcgaaccacggacaccccacctctccatattta |
36564403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #240
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 38618744 - 38618701
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
38618744 |
tattatatgcaagggccggggttcgaaccccggacaccccactt |
38618701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #241
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 39777761 - 39777876
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| | ||||||| | | |||| ||||| | || ||| ||||||||||||||| | ||||| ||| | |
|
|
| T |
39777761 |
gtgagtttagctcagttggtagggacattgtataatttatgcagtgacaggggtttgaacctctgatacctcacttctccacatttaaaatgtgagaatt |
39777860 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
| ||||| |||||||| |
|
|
| T |
39777861 |
ccagccattaggctac |
39777876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #242
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 201
Target Start/End: Original strand, 42158891 - 42158957
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| || | | || ||||||||||||| |||| |||| |
|
|
| T |
42158891 |
ttagctcagtttgtagggatattgcatattatatacaag-gtcggggttcgaaccccgaacactccac |
42158957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #243
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 436628 - 436542
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| | |||||| | | || |||||||| | || ||||| |||||| |||||||| |
|
|
| T |
436628 |
gtgagtttagctcagttggtagggacattgtataatttatgcaagggtcgcggttcgaatctcgaacacctcacttcatcacattta |
436542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #244
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 242
Target Start/End: Complemental strand, 4054269 - 4054207
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||| ||| ||| ||||||| |||| ||||| |
|
|
| T |
4054269 |
gttcgaaccccgaacaccccacttctccatatttaattgtatgagctctagctactaagctac |
4054207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #245
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Original strand, 17861979 - 17862021
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
17861979 |
gtgagtttagctcagttggtagggacaatgcataatatatgca |
17862021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #246
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 203
Target Start/End: Original strand, 20191439 - 20191516
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| ||| |||| |||||| |||||| ||||| ||||||||||| | || |||||||||||||||||| |||||| |
|
|
| T |
20191439 |
ctgtgagcttaactcacttggtaagggataatgcat-ttatatgcaggggtcggggttcgaaccccggacactccactt |
20191516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #247
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 21261819 - 21261739
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||||||| |||||| || |||||| ||||||||||| | || ||||||||| || ||||| ||||||||||||| |
|
|
| T |
21261819 |
gtgagcttagctcagtcggtagg-atgttgcattttatatgcaggggtcg-ggttcgaactccagacactccacttctccaca |
21261739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #248
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 203
Target Start/End: Original strand, 21715414 - 21715480
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| || ||||||||||||||||||||||||| | |||||||||| |||||||||| ||||| |
|
|
| T |
21715414 |
gctcaattagtagggatattgcatattatatgcaatgactgaggttcgaatcccggacacctcactt |
21715480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #249
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 203
Target Start/End: Original strand, 21789330 - 21789396
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| || ||||||||||||||||||||||||| | | || ||||||| |||||||||| ||||| |
|
|
| T |
21789330 |
gctcaattagtagggatattgcatattatatgcaaggactgaagttcgaatcccggacacctcactt |
21789396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #250
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 172
Target Start/End: Original strand, 24132934 - 24132984
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||| ||||| |||||||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
24132934 |
atccccgtgagcttagctcagttgatagagatattgcgtattatatgcagg |
24132984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #251
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 172
Target Start/End: Complemental strand, 40098795 - 40098757
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
40098795 |
ttagctcagttgttaggaatattgcatattatatgcagg |
40098757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #252
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 42317408 - 42317511
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| || | ||| |||| || |||| ||||||||||||| ||| | | ||||| |||||||| |
|
|
| T |
42317408 |
ttagctcagttggtagggatattgcatat------caggagtcgggattcaaacctcgaacactccacttctccacaattaaattatgtgagctctagcc |
42317501 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||| ||||| |
|
|
| T |
42317502 |
actaagctac |
42317511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #253
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 42366933 - 42367015
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| ||||||| || | ||||||| || |||||||| | ||||||||||| |
|
|
| T |
42366933 |
gtgagtttagctcaattggtaaggatattgcattttatatgtagaggttgaggttcaaattccggacactcaacttctccaca |
42367015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #254
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 223
Target Start/End: Original strand, 3165998 - 3166079
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||||| |||||||| | |||| ||| | | |||||||||| ||||| |||||||| |||||||||| ||||||| |
|
|
| T |
3165998 |
gttggtagggacattgcataatttatgtaggggttggggttcgaacctcggacgccccacttttccacatttaactgtgtga |
3166079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #255
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 171
Target Start/End: Complemental strand, 7845070 - 7845037
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
7845070 |
ctcagttgctagggatattgcatattatatgcag |
7845037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #256
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Original strand, 11795504 - 11795537
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatat |
155 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
11795504 |
atccctgtgagcttagctcagttggtagggatat |
11795537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #257
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 15085431 - 15085544
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| |||||||| ||| ||| | |||||||| | |||||||| | ||| ||||||||||||| ||| || ||| ||||||| | ||||| | |||| |
|
|
| T |
15085431 |
tgagcttagctcaattgatagaaacattgcataatttatgcagggactgagattcgaaccccggatacctcatttccccacattgaattgtgtaagctct |
15085530 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15085531 |
agccactaggctac |
15085544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #258
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 16210996 - 16210884
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| |||||||| |||||||||| ||| |||| |||||| ||| | | |||||||||||| | |||||||||||||| ||||| | ||||| || |
|
|
| T |
16210996 |
tgagcttagctcaattggtagggacattacataatatatgtagggtcag-ggttcgaaccccaggtaccccacttctccatatttaaaaatgtgagcttc |
16210898 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16210897 |
agccactaggctac |
16210884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #259
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 18478010 - 18478078
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| ||||||||| || |||| ||||||||||| ||||||||||||| |
|
|
| T |
18478010 |
tagctcagttggtagg-acaatgcattattatatgctggggccggggttcgaaccctggacaccccactt |
18478078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #260
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 18872528 - 18872596
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| | || ||||||||||||| ||||||||||| |
|
|
| T |
18872528 |
tagctcagttggtagg-acaatgcattattatatgcaggggtcggggttcgaaccccgaacaccccactt |
18872596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #261
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 19059092 - 19059024
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| || ||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
19059092 |
tagctcagttggtagg-acaatgcattatcatatgcaggggccggggttcgaaccctggacaccccactt |
19059024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #262
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 210
Target Start/End: Original strand, 22646669 - 22646758
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| | ||| |||| |||| |||||||||||| | || ||||||| |||| || |||||||||||| |||| ||||||||||||| |
|
|
| T |
22646669 |
tatccccgcgagcttagatcagatggtagggatatcgtatgttatatgtaggaatcggggttcgaaccccaaacactccacttctccaca |
22646758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #263
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 25660919 - 25660987
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||||||||| |||| | |||||||||| |||||||||||| |
|
|
| T |
25660919 |
tagctcagttggcagggatat-gcattgttatatgcaggggccgggattcgaaccccagacaccccactt |
25660987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #264
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 27545217 - 27545132
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||| || ||||||||||| | |||||| |||||||| | | |||||||| || | |||||||| ||||||| || ||||| |
|
|
| T |
27545217 |
tgagtttaggtcggttggtagggacaatgcataatatatgcaagggtcgaggttcaaatctcggacacctcacttcttcatattta |
27545132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #265
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 146 - 242
Target Start/End: Complemental strand, 31700433 - 31700336
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||| |||||| | ||| |||| | |||||| |||||||| || ||||| ||||||| ||||||| | |||||||| |
|
|
| T |
31700433 |
gtagggatattgcatattatatgtaggagctggagtttgaactctggacacttcacttctctacaatttaattgtgtgagctctagctattaggctac |
31700336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #266
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 37303940 - 37304009
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | || || |||||||||||| | || ||||||||||| ||||||||||||| |
|
|
| T |
37303940 |
tagctcagttggcagggacaatgtattattatatgcaggggtcggggttcgaaccctggacaccccactt |
37304009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #267
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 42801529 - 42801461
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||| | ||| ||||| |||||||||||| | || ||||||||||||||||||| ||||| |
|
|
| T |
42801529 |
tagctcagttggtatg-ataatgcattattatatgcaggggtcggggttcgaaccccggacacctcactt |
42801461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #268
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 187
Target Start/End: Original strand, 2148583 - 2148619
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaac |
187 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| |
|
|
| T |
2148583 |
gatattgcatattatatgcaggggtcgaggttcgaac |
2148619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #269
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 172
Target Start/End: Original strand, 4393859 - 4393903
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||| |||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
4393859 |
gtgagcttagttcagttggtagggatgttgcattttatatgcagg |
4393903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #270
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 195
Target Start/End: Original strand, 5555357 - 5555417
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
|||||||||||||||| | |||||||| | |||||||| |||| | |||||| |||||||| |
|
|
| T |
5555357 |
tagctcagttggtaggtacattgcataatttatgcaggggccgggtttcgaaacccggaca |
5555417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #271
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 172
Target Start/End: Complemental strand, 7064865 - 7064821
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||| |||||||||| |
|
|
| T |
7064865 |
gtgagtttaactcagttggtaggaacattgcatactatatgcagg |
7064821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #272
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 233
Target Start/End: Complemental strand, 8149109 - 8148997
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||| | ||||| ||| |||||||||| | | |||||||| || |||||| | |||||||||| ||||| |||| |
|
|
| T |
8149109 |
atccccgtgagcttaactcagttggtatgaatattacatgttatatgcagaggtcagggttcgaaacctggacactctacttctccacaatttaattgtg |
8149010 |
T |
 |
| Q |
221 |
tgaactctagcca |
233 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
8149009 |
tgagctctagcca |
8148997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #273
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 168
Target Start/End: Complemental strand, 8752615 - 8752575
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
8752615 |
gtgagtttagctcaattggtagggatattatatattatatg |
8752575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #274
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 208
Target Start/End: Complemental strand, 9119858 - 9119779
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| |||| |||||| ||||| |||||||||||||| ||||||||||| ||| |||| | |||||| | ||||||||| |
|
|
| T |
9119858 |
gtgagcttagttcagttagtagg-atattgcatattatttgcaggagccggagtttgaactctggacactcaacttctcca |
9119779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #275
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 10106637 - 10106705
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| || ||||||||| ||| ||| | |||||||||||||||||||||||| |
|
|
| T |
10106637 |
tagctcagttggcagggacatccattattatatgtaggggccaaagttcgaaccccggacaccccactt |
10106705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #276
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 10804289 - 10804181
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtgaactctagcca |
233 |
Q |
| |
|
||||| |||||||| ||||||||| | ||||||| ||| |||| |||||||| || |||| | |||| | |||| ||| || |||||| ||||||||| |
|
|
| T |
10804289 |
tagcttagttggtatggatattgccttttatatgtagggaccgatgttcgaactccaaacactcaacttattcacagttaaattgtgtgagctctagcca |
10804190 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
10804189 |
ctaggctac |
10804181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #277
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 191
Target Start/End: Complemental strand, 17242750 - 17242678
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
191 |
Q |
| |
|
|||||||| ||||| |||||||||||| | ||||| |||||| |||||||| | ||| ||||||||||||| |
|
|
| T |
17242750 |
tttatccccgtgagcatagctcagttggcaaggataatgcatagtatatgcaaggtccgcggttcgaaccccg |
17242678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #278
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 18147719 - 18147787
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
||||||||||||||||| || ||| | |||||| ||||||||||| ||| ||||| | |||||| |||| |
|
|
| T |
18147719 |
tgagtttagctcagttgataaggacaatgcataatatatgcaggatccggggttcaacccccggtcacc |
18147787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #279
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 18890380 - 18890446
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacattt---atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| | |||||||| ||||| ||||||| |||| |
|
|
| T |
18890380 |
ggttcgaacacaggacaccccacttctccacatttaaaaaatgtgtgacctctaaccactagactac |
18890446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #280
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 20071496 - 20071432
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||||||||||||| |||| | ||| | |||||||| |||||||||||| |||| |
|
|
| T |
20071496 |
ggttcgaacctcggacaccccacttttccataattaaattgtgtgaattctagccactagactac |
20071432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #281
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 25830809 - 25830749
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccc |
189 |
Q |
| |
|
|||| |||||||| |||| | ||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
25830809 |
tgagcttagctcaattggcaaggacgttgcatattatatgcaggggccgagattcgaaccc |
25830749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #282
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 195
Target Start/End: Original strand, 27498587 - 27498655
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcagga-gccgaggttcgaaccccggaca |
195 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||| | ||| |||| || | ||||||||||||||||| |
|
|
| T |
27498587 |
gtgagcttagctcggttggtagggatattgcataatgtatataggaggcgggggttcgaaccccggaca |
27498655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #283
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 167
Target Start/End: Original strand, 28581179 - 28581227
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||||| |||||| ||| || | ||||||||||||||||||||||||| |
|
|
| T |
28581179 |
tttatccttgtgagcttaacttaattggtagggatattgcatattatat |
28581227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #284
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 28906807 - 28906895
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||||||||| ||||||||| | ||||||| | |||||| ||| ||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
28906807 |
ctgtaagtttagctcggttggtaggaactttgcataatttatgcatgagttagggttcgagccacggacactccacttctccacattta |
28906895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #285
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 28943202 - 28943290
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||||||||| ||||||||| | ||||||| | |||||| ||| ||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
28943202 |
ctgtaagtttagctcggttggtaggaactttgcataatttatgcatgagttagggttcgagccacggacactccacttctccacattta |
28943290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #286
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 166
Target Start/End: Complemental strand, 32392187 - 32392155
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattata |
166 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
32392187 |
ttagcttagttggtagggatattgcatattata |
32392155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #287
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 210
Target Start/End: Complemental strand, 34824564 - 34824492
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||| |||||||| | ||||||||||| | || |||| ||| |||| |||| ||||||||||||| |
|
|
| T |
34824564 |
ctcagtcggtagagatattgcgttttatatgcaggggtcggggtttgaatcccgaacactccacttctccaca |
34824492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #288
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 203
Target Start/End: Complemental strand, 35168680 - 35168652
Alignment:
| Q |
175 |
ccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35168680 |
ccgaggttcgaaccccggacaccccactt |
35168652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #289
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 192 - 236
Target Start/End: Complemental strand, 35317417 - 35317373
Alignment:
| Q |
192 |
gacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||| ||||||| |||||||| |||||||||||| |||||||| |
|
|
| T |
35317417 |
gacacctcacttcttcacatttaaatgtgtgaactccagccacta |
35317373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #290
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 168
Target Start/End: Original strand, 42885832 - 42885872
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
42885832 |
gtgagcttagctaagttggtagagatattgcatattatatg |
42885872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 352)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 118 - 242
Target Start/End: Complemental strand, 46775107 - 46774982
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata- |
216 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |
|
|
| T |
46775107 |
atttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaat |
46775008 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
46775007 |
tgtgtgagctctagccactaggctac |
46774982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 43596891 - 43597013
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
43596891 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
43596990 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
43596991 |
gtgagctctagccactaggctac |
43597013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 3036128 - 3036007
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacaccccacttctccacaattaaattgtg |
3036029 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
3036028 |
tgagctctagccactaggctac |
3036007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 43147457 - 43147336
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
43147358 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
43147357 |
tgagctctagccactaggctac |
43147336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 46582630 - 46582752
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||| ||| |
|
|
| T |
46582630 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccagacactccacttctccacaatttaattgt |
46582729 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||| |||||||| |||| |
|
|
| T |
46582730 |
gtgagttctggccactagactac |
46582752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 49901478 - 49901600
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||| ||| | ||| |
|
|
| T |
49901478 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccgcttctccacaattaaattgt |
49901577 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
49901578 |
gtgagctctagccactaggctac |
49901600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 6371111 - 6371232
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||| ||| | |||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttcttcacaattaaattgtg |
6371210 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
6371211 |
tgagctctagccactaggctac |
6371232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 55251424 - 55251303
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
55251424 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
55251325 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||| ||||||| |
|
|
| T |
55251324 |
tgagctctagccaccaggctac |
55251303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 26868344 - 26868466
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
26868344 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccacttctccacaattaaattg |
26868442 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| || ||||||||||||||| |
|
|
| T |
26868443 |
tgtgagctttagccactaggctac |
26868466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 3847678 - 3847799
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgatccccggacactccacttctccacaattaaattgtg |
3847777 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
3847778 |
tgagttctagccactaggctac |
3847799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 118 - 242
Target Start/End: Original strand, 4590239 - 4590364
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttata |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
4590239 |
atttatccccgtgagtttagctcagttggtagggatattgcatattatatacaggggctgaggttcgaaccccagacactccacttctccacaatttaat |
4590338 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| || ||||||||||||||| |
|
|
| T |
4590339 |
tgtgtgagctttagccactaggctac |
4590364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 8965091 - 8965212
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||| ||| | |||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctctacaattaaattgtg |
8965190 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
8965191 |
tgagctctaaccactaggctac |
8965212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 46105532 - 46105653
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
46105631 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || |||||| |||||||| |
|
|
| T |
46105632 |
tgagctatagccattaggctac |
46105653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 627050 - 626934
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||| ||||||||||||| ||| | ||||||| | |
|
|
| T |
627050 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaagagctggggttcgaaccccggacactccacttctccacaattaaattgtgtgagc |
626951 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
626950 |
tctaaccactaggctac |
626934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 26919544 - 26919420
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||| |||||||| |||| ||| | | |
|
|
| T |
26919544 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttcttcacaattaaatt |
26919445 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
26919444 |
gtgtgagctctagccactaggctac |
26919420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 143 - 242
Target Start/End: Original strand, 2688114 - 2688213
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||| ||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
2688114 |
ttggtagggatattgcatattatatgcaggagctgtggttcgaatcccggacaccccatttctccacatttaaatgtgtgagctctagccactaggctac |
2688213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 48569251 - 48569128
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||||| ||||| |||||||||||| ||||| || |
|
|
| T |
48569251 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattg |
48569152 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
48569151 |
tgtgagctctagccactaggctac |
48569128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 141 - 242
Target Start/End: Complemental strand, 12582082 - 12581980
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| ||||||||||||||| |
|
|
| T |
12582082 |
agttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggc |
12581983 |
T |
 |
| Q |
240 |
tac |
242 |
Q |
| |
|
||| |
|
|
| T |
12581982 |
tac |
12581980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 117 - 242
Target Start/End: Complemental strand, 22788752 - 22788626
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttat |
215 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||| ||||| |
|
|
| T |
22788752 |
aatttattcccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggtttgaatcccggacaccccacttctccacaatttaa |
22788653 |
T |
 |
| Q |
216 |
atgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| | ||||||||||| |||| |
|
|
| T |
22788652 |
ttgtgtgagcactagccactagactac |
22788626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 45126128 - 45126250
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |||||||||||| ||||| ||| |
|
|
| T |
45126128 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggagctgaggttcgaaccccagacactccacttctccacaatttaattgt |
45126227 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| || ||||||||||||||| |
|
|
| T |
45126228 |
gtgagctttagccactaggctac |
45126250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 637096 - 637217
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
637096 |
atccccgtgagcttagctcagctggtaggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
637195 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
637196 |
tgtgctctagccactaggctac |
637217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 1458079 - 1457970
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| ||||| || |
|
|
| T |
1458079 |
ttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaacc |
1457980 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
1457979 |
actaggctac |
1457970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 21935486 - 21935595
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | ||||||| || ||||| |
|
|
| T |
21935486 |
ttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctttagcc |
21935585 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
21935586 |
actagactac |
21935595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 47934145 - 47934024
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
47934145 |
atccccgtgagcttagctcagttggtagggatatggcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtg |
47934046 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
47934045 |
tgagctctagccactagactac |
47934024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 49757357 - 49757236
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||| ||| | |||| |
|
|
| T |
49757357 |
atccccgtgagcatagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtg |
49757258 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
49757257 |
tgagctctagccactaggctac |
49757236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 51890800 - 51890913
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||| ||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
51890800 |
gtgagcttagctcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtgagctc |
51890899 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51890900 |
tagccactaggcta |
51890913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 33933811 - 33933691
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgt |
221 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||| |||||||||| |||| ||||||| ||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcaggggccggggttcgacccctggacaccccacttctccacatttaatatgtgt |
33933712 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| || ||||||||||||||| |
|
|
| T |
33933711 |
gagctatagccactaggctac |
33933691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 42231515 - 42231630
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
42231515 |
gtgagcttaactcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
42231614 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
42231615 |
ctagtcactaggctac |
42231630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 141 - 242
Target Start/End: Original strand, 2222555 - 2222657
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggc |
239 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | ||||||| ||||||||||||||| |
|
|
| T |
2222555 |
agttggtagggatattgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccactaggc |
2222654 |
T |
 |
| Q |
240 |
tac |
242 |
Q |
| |
|
||| |
|
|
| T |
2222655 |
tac |
2222657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 118 - 242
Target Start/End: Complemental strand, 7686339 - 7686214
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata- |
216 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| |||||||||| ||||||||||| |||| ||||||||||| |||||| ||||||||||||| ||| | |
|
|
| T |
7686339 |
atttatccccgtgagcttagctcagttggtagagatattgcattttatatgcaggggccggggttcgaaccctggacactccacttctccacaattaaat |
7686240 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||| |||||||| |
|
|
| T |
7686239 |
tgtgtgagctctagccattaggctac |
7686214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 15064269 - 15064160
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| || ||||||||||| | ||| | ||||||| || |
|
|
| T |
15064269 |
gtgagtttagctcagttggtaggaatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccataattaaattgtgtgagct |
15064170 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
15064169 |
ctagccacta |
15064160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 36132226 - 36132347
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
36132226 |
atccccgtgagtttagctcaattggtaggaatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtg |
36132325 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||| |||||||||||| |
|
|
| T |
36132326 |
tgaggtctaaccactaggctac |
36132347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 118 - 242
Target Start/End: Original strand, 39023168 - 39023293
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttata |
216 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| | || ||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
39023168 |
atttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccacaatttaat |
39023267 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| | ||||||||||||||||| |
|
|
| T |
39023268 |
tgtgtaagttctagccactaggctac |
39023293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 40051619 - 40051740
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| ||| | | |||||||||||| ||||||||||||||||||| ||| | |||| |
|
|
| T |
40051619 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggtaggggttcgaaccccagacaccccacttctccacaattaaattgtg |
40051718 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
40051719 |
tgagctctagccactaggctac |
40051740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 45112184 - 45112064
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| | ||| | |||| |
|
|
| T |
45112184 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgtg |
45112085 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||| ||||||||||| |
|
|
| T |
45112084 |
tgagctctag-cactaggctac |
45112064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 8848280 - 8848164
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacccca-cttctccacatttatatgtgtgaac |
225 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||| ||||||||||| | |||||| | | |
|
|
| T |
8848280 |
tgtgagcttagttcagttggtagggatattgcatattatatacaggggccggggttcgaaccccggacaccccatattctccacattaaaatgtgtaagc |
8848181 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8848180 |
tctagccactaggctac |
8848164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 30057232 - 30057340
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | || ||||| |||||||||||||||||||||||||| ||| | ||||||| ||||| ||| |
|
|
| T |
30057232 |
tagctcagttggtagggatattgcatattatatgcaggggtcggggttcaaaccccggacaccccacttctccacaattaaattgtgtgagctctaacca |
30057331 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
30057332 |
ctaggctac |
30057340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 37251111 - 37251231
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgt |
221 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||| ||||||||||||| ||| | ||||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatattttatgcaggagccggggttcgaacatcggacactccacttctccacaattaaattgtgt |
37251210 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
37251211 |
gaactctagccactagactac |
37251231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 42395225 - 42395345
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgt |
221 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||| ||| |||| ||||||||| |||||||||||||||||||||| ||| | ||||| |
|
|
| T |
42395225 |
tccctgtgagcttagcttagttggtagggatattgcatattatatgtaggggccggggttcgaactccggacaccccacttctccacaattaaattgtgt |
42395324 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| || |||||||||| |||| |
|
|
| T |
42395325 |
gagctttagccactagactac |
42395345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 43905723 - 43905827
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
43905723 |
ctcagttggtagggatattgcatgttatatgcagggatcggggttcgaaccccggacaccccacttctccacgtttaattgtgtgagctctagccactag |
43905822 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
43905823 |
gctac |
43905827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 121 - 240
Target Start/End: Complemental strand, 51512083 - 51511963
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||| ||||||||||||| ||| | | | |
|
|
| T |
51512083 |
tatccccgtgagctgagctcagttggtagggatattgcatattatatgctgtagccggggttcgaaccccggacactccacttctccacaattaaattat |
51511984 |
T |
 |
| Q |
220 |
gtgaactctagccactaggct |
240 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
51511983 |
gtgagctctagccactaggct |
51511963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 542881 - 542769
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||| |||||||| || | ||||||||| ||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
542881 |
gtgagcttagctcagttgatagggatattgcatattgtatgcaggggctggggttcgaacttcggacactccacttctccacatt--tatgtgtgaactc |
542784 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
542783 |
tagccactaggctac |
542769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 3815063 - 3815178
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||| || ||||||||||||| ||||| ||||| | || |
|
|
| T |
3815063 |
gtgagcttagcttagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggatactccacttctccacaattatattgtgtaagct |
3815162 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
3815163 |
ctagccactagcctac |
3815178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 4234360 - 4234237
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||| |||||| ||| | || |
|
|
| T |
4234360 |
ttatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaacctcggacactccacttttccacaattaaattg |
4234261 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||| ||| |||| |
|
|
| T |
4234260 |
tgtgagctctagccattagactac |
4234237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 5305077 - 5304962
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
5305077 |
gtgagcttatctcagttggtaggaatatcgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
5304978 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5304977 |
ctagccactaggctac |
5304962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 121 - 231
Target Start/End: Complemental strand, 11375963 - 11375852
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||| ||| | |||| |
|
|
| T |
11375963 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaaatgt |
11375864 |
T |
 |
| Q |
220 |
gtgaactctagc |
231 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
11375863 |
gtgagctctagc |
11375852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 238
Target Start/End: Complemental strand, 22230501 - 22230390
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||| ||| | ||||||| || |
|
|
| T |
22230501 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctcaacaattaaattgtgtgagct |
22230402 |
T |
 |
| Q |
227 |
ctagccactagg |
238 |
Q |
| |
|
|| |||||||| |
|
|
| T |
22230401 |
ttaaccactagg |
22230390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 40994170 - 40994055
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||| | |||||||| ||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
40994170 |
gtgagcttagctcagttggtagggatattgcatattatatgtaggagttggggttcgaatcccggacactccacttctccacaattaaattgtgtgagct |
40994071 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40994070 |
ctagccactaggctac |
40994055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 55055914 - 55056033
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| | |||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
55055914 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgcaggggccgaggttcgaaccccggacacgccacttctccacatttaattgtgtg |
55056013 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||| | |||||| ||||| |
|
|
| T |
55056014 |
agctccaaccactacgctac |
55056033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 4701004 - 4700890
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| | || || ||||||||||||| ||||||||||||| ||||| ||||||| ||| |
|
|
| T |
4701004 |
tgagtttagctcagttggtagggatattgtatattatatgcaggggtcggtgtccgaaccccggacatcccacttctccacaatttaattgtgtgagctc |
4700905 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4700904 |
tagccactaggctac |
4700890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 10417287 - 10417173
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | ||||||| ||| |
|
|
| T |
10417287 |
tgagcttagctcagttggtagggatattacatattatatgcaggagtcagggttcgaaccccggacactccacttctccacaattaaattgtgtgagctc |
10417188 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
10417187 |
tagccactagactac |
10417173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 11294905 - 11294791
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| |||| |||| ||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||||||||||| |||| ||| ||| |
|
|
| T |
11294905 |
gtgagcttaactcaattggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaatgtttgagctc |
11294806 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11294805 |
tagccactaggctac |
11294791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 233
Target Start/End: Complemental strand, 12504710 - 12504604
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
12504710 |
gtgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccacaattaaattgtgtgagct |
12504611 |
T |
 |
| Q |
227 |
ctagcca |
233 |
Q |
| |
|
||||||| |
|
|
| T |
12504610 |
ctagcca |
12504604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 31852352 - 31852466
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||| ||||| |||| ||| | |||||| | ||||||||||||||||||||||||||||||||||| ||||| ||||||| ||| |
|
|
| T |
31852352 |
gtgagcttagctcagttggcagggacattgtataatttatgcaagggccgaggttcgaaccccggacaccccacttctccatatttaattgtgtgagctc |
31852451 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31852452 |
tagccactaggctac |
31852466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 35219574 - 35219453
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||| |||||||||||| ||| | ||| |
|
|
| T |
35219574 |
tatccccgtgagcttagctcagttggtagggatattgcatatta-atgcaggagtcggggttcgaaccccggacactccacttctccactattaaattgt |
35219476 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|| | |||||||||||||||||| |
|
|
| T |
35219475 |
gtaagctctagccactaggctac |
35219453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 47929241 - 47929363
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgt |
219 |
Q |
| |
|
|||| ||||||| |||||||| ||||| | ||||||||||||||||||||| | ||||||||||||| |||| ||||||||||||||||||| | |||| |
|
|
| T |
47929241 |
tatctctgtgagcttagctcatttggtgagaatattgcatattatatgcaggggtcgaggttcgaacctcggaaaccccacttctccacatttaaaatgt |
47929340 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
47929341 |
gtgagctctagccactaggctac |
47929363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 49447125 - 49447239
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||| |||||| |||||||||||| ||||| |||||| ||| |
|
|
| T |
49447125 |
tgagcttagctcagttggtaaggatattgcatattatatgtaggagccggggttcgaaccctggacactccacttctccacaatttaattgtgtgggctc |
49447224 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49447225 |
tagccactaggctac |
49447239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 133 - 242
Target Start/End: Original strand, 54534834 - 54534944
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
54534834 |
tttagctcagttggtagggatattgcatattatatgcaaagttcggggttcgaaccacggacaccccacttctccacatttaatatgtgtgagctctagg |
54534933 |
T |
 |
| Q |
232 |
cactaggctac |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
54534934 |
cactaggctac |
54534944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 55853182 - 55853060
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |||||||||||||||||||||| |||| |||||||||||| ||| ||||||||| |||| ||| | ||| |
|
|
| T |
55853182 |
tatccccgtgagcttagctcagttggtagagatattgcatattatatgcaggggccggtgttcgaaccccgaacatcccacttcttcacaattagattgt |
55853083 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
55853082 |
gtgagctctagccactaggctac |
55853060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 9761112 - 9761233
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||| ||| | |||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtg |
9761211 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| ||||||| |||| |
|
|
| T |
9761212 |
tgagctctaaccactagactac |
9761233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 10402438 - 10402559
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||| |||||||||||||||||||||| | || |||||||||||||||||| |||||||||||| ||| | |||| |
|
|
| T |
10402438 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgcaggggtcggagttcgaaccccggacacctcacttctccacaattaaattgtg |
10402537 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
10402538 |
tgagctctagccactaggctac |
10402559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 125 - 242
Target Start/End: Complemental strand, 17815495 - 17815378
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaa |
224 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| ||||||||||||||| | || |||||||| ||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
17815495 |
cctgtgagcttagttcagttggtagggatattacatattatatgcaggggtcggggttcgaatccctgacaccctacttctccatatttatatgtgtgag |
17815396 |
T |
 |
| Q |
225 |
ctctagccactaggctac |
242 |
Q |
| |
|
|| ||||||||| ||||| |
|
|
| T |
17815395 |
ctttagccactaagctac |
17815378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 37935858 - 37935979
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | ||||||||| || ||||| ||||||||||| ||||| |||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaactccagacacaacacttctccacaatttaattgtg |
37935957 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
37935958 |
tgagctctagccactaggctac |
37935979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 40486453 - 40486558
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||| |||| |||||||||||||| | |||||||| |||| |||||||||||||||||| |||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
40486453 |
gctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttcacatttaaatgtgtgagctctagccacta |
40486552 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
40486553 |
ggctac |
40486558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 48615529 - 48615424
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| || ||||||||||||| ||| | ||||||| |||||| ||||| |
|
|
| T |
48615529 |
ctcagttggtagggatattgcatattatatgcagaagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagctctagtcacta |
48615430 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
48615429 |
ggctac |
48615424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 49264529 - 49264642
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| ||||||| | || || |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
49264529 |
gtgagtttaactcagttagcagagacattgcataacttatgcaggggccgaggttcgaaccccggacaccccacttctccacatttaattgtgtgagctc |
49264628 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49264629 |
tagccactaggcta |
49264642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 56088015 - 56087906
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||| |||||||| ||||||||||||||||||||||| ||| | ||||||| ||||||| |
|
|
| T |
56088015 |
ttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagttctagcc |
56087916 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
56087915 |
actagactac |
56087906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 4958629 - 4958541
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccaca |
4958541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 46998436 - 46998320
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||| ||||||||||||||| | |||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| | |
|
|
| T |
46998436 |
tgtgagcttagctcagttggtatgaatattgtatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagc |
46998337 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||||||| ||| |||| |
|
|
| T |
46998336 |
tctagccattagactac |
46998320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 13264349 - 13264226
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| |||| || |||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||| |||| ||| | || |
|
|
| T |
13264349 |
ttatccccatgagcttcgctcagttggtagggatattgcatattatatgcaaggaccggggttcgaaccccggacaccccacttcttcacaattaaattg |
13264250 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||||| |||| |
|
|
| T |
13264249 |
tgtgagctctagccactagactac |
13264226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 138 - 241
Target Start/End: Complemental strand, 23924929 - 23924826
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||| |||||||||| |||||||| | |||||||| |||| |||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
23924929 |
ctcaattggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacttcacttctccacatttatttgtgtgagctctagccactag |
23924830 |
T |
 |
| Q |
238 |
gcta |
241 |
Q |
| |
|
|||| |
|
|
| T |
23924829 |
gcta |
23924826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 112 - 242
Target Start/End: Original strand, 42218737 - 42218868
Alignment:
| Q |
112 |
atttgaatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-a |
210 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||||||||||||||||||| | ||| || | ||||||||| |||||||| |||||||||||| | |
|
|
| T |
42218737 |
atttaaatttatccccgtgaacttagctcagttggtagggatattgcatattatacgtaggggctggggttcgaactccggacactccacttctccacaa |
42218836 |
T |
 |
| Q |
211 |
tttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||| || ||||||||||||||| |
|
|
| T |
42218837 |
tttaattgtgtgagctttagccactaggctac |
42218868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 50457781 - 50457666
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||| ||||| |||| || || |
|
|
| T |
50457781 |
gtgagcttagctcagttggtaaggatattgcatattatatgcaggggccagggttcgaaccccggacactccacttctccacaatttaattgtgcgagct |
50457682 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
50457681 |
gtagccactaggctac |
50457666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 13578532 - 13578450
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
13578532 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccaca |
13578450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 45849043 - 45849165
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||| |||||||| || | |||||||||| |||||| |||||||||||| ||||| ||| |
|
|
| T |
45849043 |
tatccccgtgagcttagctcagttggtagggatattgcatattttatgcaggggctggagttcgaaccctggacactccacttctccacaatttaattgt |
45849142 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
45849143 |
gtgagttctagccactaggctac |
45849165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 47890691 - 47890813
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||||| | |||||||||||| |||||||||||||||||||||| | || |||||||||||| ||||| ||||||||||||| ||| | ||| |
|
|
| T |
47890691 |
tatccccgtgagttaaactcagttggtagagatattgcatattatatgcaggggtcggggttcgaaccccagacactccacttctccacaattaaattgt |
47890790 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| |||||||||||| |
|
|
| T |
47890791 |
gtgagctctaaccactaggctac |
47890813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 136 - 210
Target Start/End: Original strand, 49056786 - 49056860
Alignment:
| Q |
136 |
agctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49056786 |
agctcagttggtagggacattgcatattatatgcaggagccggagttcgaaccccggacaccccacttctccaca |
49056860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 53634317 - 53634203
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||| |||||| |||||||||||||||||||||| ||||||| | | |||||||||||||||| ||||||||||||| ||| | ||||||| ||| |
|
|
| T |
53634317 |
tgagcttagttcagttcgtagggatattgcatattatatacaggagctgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctc |
53634218 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53634217 |
tagccactaggctac |
53634203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 25235870 - 25235749
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||| |||||||||||||||||||||||||||||||| || | |||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
25235870 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtg |
25235771 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||| |||||||||| |
|
|
| T |
25235770 |
tgagttctagctactaggctac |
25235749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 29771366 - 29771257
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||| ||| |||||||||||| ||||| ||| ||| || |
|
|
| T |
29771366 |
gtgagcttagctcaattggtagggatattgcatattatatgcaggggccggggttcgaaccccgggcactccacttctccacaatttaattgtttgagct |
29771267 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
29771266 |
ctagccacta |
29771257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 43207666 - 43207787
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||| ||||| ||||||| ||| | |||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagcttgggttcgaatcccgaacattccactactccacaattaaattgtg |
43207765 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
43207766 |
tgaactctagccattaggctac |
43207787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 43481112 - 43480996
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||| ||||||||||| |||| |||||||| ||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
43481112 |
atccccgtgagcttaactcagttggtagggatattgcactttatatgcaggggccggggttcgaa-cccggacactccacttctccacaattaaattgtg |
43481014 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43481013 |
tgaactctagccactagg |
43480996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 55021563 - 55021672
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| | || |||||||||||||||||| |||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
55021563 |
ttagctcagttggtaggaatattgcatattatatgcaggggtcggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagcc |
55021662 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
55021663 |
actagactac |
55021672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 55536377 - 55536497
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||||||||||||||||||||||| || |||| ||||| |||||| ||||||||||||| ||| | |||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcaggag-cggggtttgaaccttggacactccacttctccacaattaaattgtg |
55536475 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
55536476 |
tgagctctagccactaggctac |
55536497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 138 - 210
Target Start/End: Complemental strand, 5179939 - 5179867
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
5179939 |
ctcagttggtaaggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccaca |
5179867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 23705226 - 23705138
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
23705226 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagctggggttcgaaccccggacacttcacttctccaca |
23705138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 55531248 - 55531372
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| || || |||||||||||||| ||||||| |||| ||||||||||| |||| ||||| |||||||||||| ||||||||| ||| ||| | | |
|
|
| T |
55531248 |
tttatccccgtaagcttagctcagttggtggggatatcgcattttatatgcaggggccggggttcaaaccccggacactccacttctcgacaattaaatt |
55531347 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
55531348 |
gtgtgaactctagccactaagctac |
55531372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 3764081 - 3763966
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||||||||||||||| || | |||||||||||| || || |||||||||||| ||||| |||| |
|
|
| T |
3764081 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtg |
3763982 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
3763981 |
tgagctctagccacta |
3763966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 5165852 - 5165974
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||| |||||||||||||||| |||| |||||||||||| ||||| |||||||||||| ||||| || |
|
|
| T |
5165852 |
ttatccccgtgagcttaactcagttggtagggatatcgcatattatatgcaggggccggggttcgaacccc-gacactccacttctccacaatttaattg |
5165950 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||| |||| |||||||| |
|
|
| T |
5165951 |
tgtgagctcttgccattaggctac |
5165974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 34353782 - 34353897
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||| ||| | | ||||| || |
|
|
| T |
34353782 |
gtgagcttagctcagttggtagggatattgcatattatatgcagaggtcagggttcgaaccccggacaccccacttctccacaattaaattatgtgagct |
34353881 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
34353882 |
gtaaccactaggctac |
34353897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 39696404 - 39696290
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||| |||| | ||||||||||| ||| | ||||||| || |
|
|
| T |
39696404 |
gtgagcttagctcagttggtagggatattgcatattatatgtaggagtcg-ggttcgaaccccgaacactctacttctccacaattaaattgtgtgagct |
39696306 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
39696305 |
ctagccactagactac |
39696290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 43271784 - 43271669
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||| ||||||| |||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
43271784 |
gtgagcttagttcagttgatagggatattgcatattatatgcagggaccagggttcgaaccccagacaccccacttctccacaattaaattgtgtgagct |
43271685 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43271684 |
atagccactaggctac |
43271669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 45741470 - 45741593
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||||||| |||| |||||||| ||||||||| |||||||||||||||| ||||||||||| ||||| |||||| |||||| ||| | || |
|
|
| T |
45741470 |
ttatccccgtgagtttaactcaattggtaggaatattgcatgttatatgcaggagccggagttcgaaccccagacactccacttatccacaattaaattg |
45741569 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| ||||||| |||| |
|
|
| T |
45741570 |
tgtgaactctaaccactagactac |
45741593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 152 - 242
Target Start/End: Complemental strand, 52731482 - 52731391
Alignment:
| Q |
152 |
atattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
52731482 |
atattgcatattatatgcaggagccggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagctctagccactaggctac |
52731391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 38228440 - 38228554
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| ||||||| ||| |||| ||||||||| ||| |||||||| |||| |||||||| ||||||| ||| |
|
|
| T |
38228440 |
gtgagcttagatcagttggtagggatattgcatgttatatgtaggggccggggttcgaactccgaacaccccatttctacacatttaattgtgtgagctc |
38228539 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
38228540 |
tatccactaggctac |
38228554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 42134523 - 42134409
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||| | | || ||||||||| |||||||||||||||||||||| ||| | | ||||| ||| |
|
|
| T |
42134523 |
tgagcttaactcagttagtagggatattgcatattatatgcaagggtcggggttcgaactccggacaccccacttctccacaattaaattatgtgagctc |
42134424 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42134423 |
tagccactaggctac |
42134409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 46903335 - 46903448
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtgtgaactc |
227 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||| | | |||| |||||||||||||||||||||||| ||||||| |||||||| ||| |
|
|
| T |
46903335 |
tgagtttagatcagttggtatggatattgcatattatatgcaggggttg-ggtttgaaccccggacaccccacttctccgcatttataatgtgtgagctc |
46903433 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| ||| |||||||| |
|
|
| T |
46903434 |
taaccattaggctac |
46903448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 129 - 235
Target Start/End: Original strand, 50512364 - 50512470
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||| | |||||||||||| | |||||| ||||||||||||||| |||||||| || | |
|
|
| T |
50512364 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggggttgaggttcgaacctctgacaccttacttctccacatttaaatgtgtgagcttt |
50512463 |
T |
 |
| Q |
229 |
agccact |
235 |
Q |
| |
|
||||||| |
|
|
| T |
50512464 |
agccact |
50512470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 53376753 - 53376631
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gt |
219 |
Q |
| |
|
|||||| | ||| |||||||| |||||||||||||||||| ||||||||| | |||| |||||||||||||||||| ||||||||||||| ||| || || |
|
|
| T |
53376753 |
tatccccgcgagcttagctcaattggtagggatattgcatgttatatgcaagggccggggttcgaaccccggacactccacttctccacaattaaatcgt |
53376654 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||| ||||| |||| |
|
|
| T |
53376653 |
gtgagctctagctactagactac |
53376631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 128 - 241
Target Start/End: Complemental strand, 53572394 - 53572280
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||||||||||||||||| | ||| |||||||||||| |||||||||||| ||||| ||||||| | |
|
|
| T |
53572394 |
gtgagcttaactcagttgatagggatattgcatattatatgcaggagccgggattcaaaccccggacactccacttctccacaatttaattgtgtgagcg |
53572295 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
53572294 |
ctaaccactaggcta |
53572280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 121 - 210
Target Start/End: Original strand, 18360489 - 18360578
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||| ||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
18360489 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccaca |
18360578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 36099256 - 36099135
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || ||||| |||||||||| | ||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
36099256 |
tccccgtgagctttgctcaattggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
36099157 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
36099156 |
tgagctccagccactaggctac |
36099135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 36602440 - 36602351
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||| ||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
36602440 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccaca |
36602351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 38848182 - 38848073
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatat-tatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||| |||| |||||||||||||| | |||||||| | || |||||||||||||||||||||||||||||||||||| |||||||| ||||| || |
|
|
| T |
38848182 |
ttagctcaattggcagggatattgcataaatttatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaatgtgtgagctctaacc |
38848083 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
38848082 |
actagactac |
38848073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 42381174 - 42381065
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||| | || |||||||||| | ||||||||||||||||||| ||| | ||||||| || ||||| |
|
|
| T |
42381174 |
ttagctcagttggtagggatattgcatgttatatgtaggggtcggggttcgaacctcagacaccccacttctccacaattaaattgtgtgagctttagcc |
42381075 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
42381074 |
actaggctac |
42381065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 229
Target Start/End: Original strand, 51777847 - 51777948
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| || ||||||||| ||||||| |||||||||||||||||| |||||||| ||| |
|
|
| T |
51777847 |
gtgagtttagctcagttagtagctatattgcatattatatgcagggatcggggttcgaactccggacatcccacttctccacatttaaatgtgtgagctc |
51777946 |
T |
 |
| Q |
228 |
ta |
229 |
Q |
| |
|
|| |
|
|
| T |
51777947 |
ta |
51777948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 2629588 - 2629696
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||| |||| ||||| |||||||| | |||||||| | || ||||||||||||| |||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
2629588 |
ttagctcaattggcagggacattgcataatttatgcaggggtcggggttcgaaccccgaacaccccacttctccacatttaattgtgtgagctctagcca |
2629687 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
2629688 |
ttaggctac |
2629696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 119 - 238
Target Start/End: Complemental strand, 12167692 - 12167573
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcagga-gccgaggttcgaaccccggacaccccacttctccacatttatat |
217 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||| ||||| |||||| ||| | || |
|
|
| T |
12167692 |
tttatccctgtgaacttaactcagttggtagggatattgcatattatatgcaggaggccggggttcgaactccggacttcccac-tctccatattaaaat |
12167594 |
T |
 |
| Q |
218 |
gtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||| ||||||||| |||| |
|
|
| T |
12167593 |
gtgtgagctctagccattagg |
12167573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 122 - 206
Target Start/End: Complemental strand, 24680159 - 24680075
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||| || ||||| ||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgaggttcgaactccagacactccacttctc |
24680075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 56479283 - 56479180
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||||||| ||||||| ||| ||| |||| ||||||| |
|
|
| T |
56479283 |
ctcagttggtagggatattgcatattatatgcaggggtcg-ggttcgaaccccggacaccccacttctttacatttagttgtctgagttctaaccactag |
56479185 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
56479184 |
gctac |
56479180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 138 - 241
Target Start/End: Original strand, 12625842 - 12625945
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||||| ||| ||||||| | |||||||| | || |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12625842 |
ctcagttggtaaggacgttgcataatttatgcaggggtcggagttcgaacaccggacaccccacttctccacatttaattgtgtgaactctagccactag |
12625941 |
T |
 |
| Q |
238 |
gcta |
241 |
Q |
| |
|
|||| |
|
|
| T |
12625942 |
gcta |
12625945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 41897615 - 41897528
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||| |||||||| | |||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
41897615 |
tgtgagattaacttagttggtagggatattgcataatatatgcacgggccgaggttcgaaccctgtacaccccacttctccacattta |
41897528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 45139948 - 45139853
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||| ||||||||||||||||||| |||| ||| | |||||||| |||| ||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
45139948 |
gtgagcttagctcagttggtagggacattgtataatttatgcaggggccggggttcgaaccccggacacctcacttctccacatttaattgtgtga |
45139853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 3784915 - 3785028
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||| | |||||||| | | ||||||||||||| ||||| |||||||||||||||| |||||||| ||| |
|
|
| T |
3784915 |
gtgagcttagctcaattggtagggatattgcataatttatgcagggtcag-ggttcgaaccccgaacaccacacttctccacatttaaatgtgtgagctc |
3785013 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
3785014 |
cagccactagactac |
3785028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 238
Target Start/End: Complemental strand, 31852687 - 31852569
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||| |||||||||||||||| ||| | | |||||||||||||||||| ||| |||||||| ||||| ||| |
|
|
| T |
31852687 |
tatccccgtgagcttatctcagttggtagggttattgcatattatatgtaggggttggggttcgaaccccggacactccatttctccacaatttaattgt |
31852588 |
T |
 |
| Q |
220 |
gtgaactctagccactagg |
238 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
31852587 |
gtgagctctagccactagg |
31852569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 42044113 - 42044027
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||||||||||||| || || |||||||| | |||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42044113 |
gtgagcttagctcagttggcagagacattgcataatttatgcaggggccgaggtttgaaccccggacaccccacttctccacattta |
42044027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 230
Target Start/End: Original strand, 52798274 - 52798383
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||||||||||||||||||||| ||| || ||||||||||||| |||| |||||||||||| ||||| ||| |
|
|
| T |
52798274 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgca-gagtcggggttcgaaccccgtacactccacttctccacaatttaattgt |
52798372 |
T |
 |
| Q |
220 |
gtgaactctag |
230 |
Q |
| |
|
|||| |||||| |
|
|
| T |
52798373 |
gtgagctctag |
52798383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 15208519 - 15208640
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||| ||||||||||||||||||||||| |||| ||| |||||||||| ||||||| ||||||||||||| ||| | |||| |
|
|
| T |
15208519 |
atccccgtgagcttaactcagtgggtagggatattgcatattatatataggaaccggggttcgaacctcggacactccacttctccacaattaaattgtg |
15208618 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| ||| |||| |
|
|
| T |
15208619 |
tgagctctagccaatagactac |
15208640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 21380256 - 21380130
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccg----aggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||| |||||||||||||| ||| |||||||||||||||||||| ||||||| || ||||||||||||| |||| ||||||||||||| ||| | |
|
|
| T |
21380256 |
tatccccgtgagtttagctcaattgctagggatattgcatattataagcaggaggcggggtgggttcgaaccccgcacactccacttctccacaattaaa |
21380157 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||| |||||||| |
|
|
| T |
21380156 |
ttgtgtgagctctagccattaggctac |
21380130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 126 - 239
Target Start/End: Original strand, 29406358 - 29406471
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaac |
225 |
Q |
| |
|
||||||| |||||||| |||||||||| |||||||| | |||||||| | || ||||||||| ||||||| |||||||||||||||||| ||||||| | |
|
|
| T |
29406358 |
ctgtgagcttagctcaattggtagggacattgcataatttatgcaggggtcggggttcgaactccggacaacccacttctccacatttaattgtgtgagc |
29406457 |
T |
 |
| Q |
226 |
tctagccactaggc |
239 |
Q |
| |
|
|| | ||||||||| |
|
|
| T |
29406458 |
tccaaccactaggc |
29406471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 146 - 242
Target Start/End: Complemental strand, 35948231 - 35948135
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |||||||||||||||||| |||| |||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
35948231 |
gtagggatatcgcattttatatgcaggagccggggttcgaaccccggacactccac-tctccacaattaaattgtgtgagctctagccactaggctac |
35948135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 117 - 233
Target Start/End: Original strand, 48798271 - 48798387
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||||||| ||||| ||||| || | |||||||||||||||||| ||| ||||||||| ||| | |
|
|
| T |
48798271 |
aattaatccccgtgagcttagctcagttggtagggatattgcattttata-gcaggggctggggttcgaaccccggacactccatttctccacaattaaa |
48798369 |
T |
 |
| Q |
217 |
-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
48798370 |
ttgtgtgagctctagcca |
48798387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 130 - 210
Target Start/End: Original strand, 14071400 - 14071480
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||| ||||||||| || |||| ||||||||||||| |
|
|
| T |
14071400 |
gagtttagctcagttggtagggatattgtattatatatgcaggagccgatgttcgaacctcgaacactccacttctccaca |
14071480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 147 - 242
Target Start/End: Complemental strand, 17617028 - 17616932
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| |||||||||||||||||| ||||||||||||| ||| | |||||| |||||||||||| ||||| |
|
|
| T |
17617028 |
tagggatattgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacaattaaattgtgtgggctctagccactaagctac |
17616932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 17872084 - 17872204
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| |||||| | ||||||||||||||||||| ||||| |||| |||| ||||||| |||||| |||||||||||||| ||||| |||| |
|
|
| T |
17872084 |
atccccgtgagcttagcttaattggtagggatattgcatagtatatacaggggccggggttcgagtcccggagaccccacttctccatatttaattgtgc |
17872183 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
17872184 |
gagttctagccactaggctac |
17872204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 42002309 - 42002417
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||| |||||||||||| |||||||| | |||| ||| |||| |||| ||||| | ||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
42002309 |
gtgagcttagcttagttggtagggacattgcataatttatgtaggggccgtggtttgaacctcagacaccccacttctccacatttaattgtgtgagctc |
42002408 |
T |
 |
| Q |
228 |
tagccacta |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
42002409 |
tagccacta |
42002417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 48744202 - 48744325
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatat |
217 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||| |||||||||||||| | | |||||||||||| |||||| |||||||||||| ||||| | |
|
|
| T |
48744202 |
tttatccccatgagcttagctcagttggtagggatataatatattatatgcagg-gactaggttcgaaccctggacactccacttctccacaatttaatt |
48744300 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
48744301 |
gtgtgagttctagccactaggctac |
48744325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 8433696 - 8433581
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||| || | || ||| ||||||||| ||| | |||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattatatccaggagctagggttcgaaccgcgaatactccaattctccacaattaaattgtg |
8433597 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
8433596 |
tgagctctagccacta |
8433581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 15604107 - 15603992
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||| |||||| ||||||||||| | || | |||||||||||||||| |||||||||||| ||||| | ||||| | |
|
|
| T |
15604107 |
gtgagcttagctcagttggtagggatgttgcattttatatgcaggggtcgggattcgaaccccggacactccacttctccacaatttaattatgtgagtt |
15604008 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
15604007 |
ctagccactaagctac |
15603992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 140 - 238
Target Start/End: Original strand, 20320456 - 20320555
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||| ||||||| |||| ||||| ||||||| ||| ||||||||| |
|
|
| T |
20320456 |
cagttggtagggatatcgcatattatatgcaggggccgaagttcgaaccccggacactccacttcaccacaatttaattgtgtgagatctggccactagg |
20320555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 34618285 - 34618400
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||| ||||||||||| | | |||| ||||||||||||| ||||||||||||| ||| | ||||||| | |
|
|
| T |
34618285 |
gtgagtttggctcagttcgtagagatattgcattttatatgcaggggttggggttggaaccccggacactccacttctccacaattaaattgtgtgagcc |
34618384 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34618385 |
ctagccactaggctac |
34618400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 238
Target Start/End: Original strand, 43978011 - 43978121
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | || |||||||| |||| |||| |||||||||||| ||||| ||| ||| || |
|
|
| T |
43978011 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaa-cccgtacactccacttctccacaatttaattgtatgagct |
43978109 |
T |
 |
| Q |
227 |
ctagccactagg |
238 |
Q |
| |
|
||| |||||||| |
|
|
| T |
43978110 |
ctaaccactagg |
43978121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 111 - 210
Target Start/End: Complemental strand, 12720719 - 12720618
Alignment:
| Q |
111 |
tatttgaatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccgg--acaccccacttctcca |
208 |
Q |
| |
|
||||| |||||||| | |||||||||| ||| ||||||||| |||||||| |||||||||||| ||| |||||||||||||| | |||||||||||||| |
|
|
| T |
12720719 |
tattttaatttatctccgtgagtttagttcaattggtaggggtattgcattttatatgcaggatccgtggttcgaaccccggataaaccccacttctcca |
12720620 |
T |
 |
| Q |
209 |
ca |
210 |
Q |
| |
|
|| |
|
|
| T |
12720619 |
ca |
12720618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 27091539 - 27091426
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| | | |||||| | || |||||||||||||||| ||||||||| || ||| || ||||||| ||| |
|
|
| T |
27091539 |
gtgagtttagctcagttggtagggacattgtataatttctgcaggggtcggagttcgaaccccggacatcccacttcttcatattaat-tgtgtgagctc |
27091441 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27091440 |
tagccactaggctac |
27091426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 27362896 - 27362814
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| |||||||||||| |||||| ||||||||||||||| ||||| |||||||||||| || ||||||||||||||| |
|
|
| T |
27362896 |
gtgagcttaactcagttggtagcgatattacatattatatgcaggggccgacgttcgaaccccgaactccccacttctccaca |
27362814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 120 - 210
Target Start/End: Complemental strand, 29329898 - 29329808
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| |||||| || ||||||| ||| |||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
29329898 |
ttatccccgtgagcttagctcagttggtaggaatattgtattttatatgtaggggccggggttcgaaccccagacactccacttctccaca |
29329808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 30217602 - 30217716
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| || ||||||| ||| ||||| ||| ||||||||| ||| | ||||||| || |
|
|
| T |
30217602 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggctagagttcgaatcccagacactccagttctccacaattaaattgtgtgagct |
30217701 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30217702 |
ttagccactaggcta |
30217716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 32955228 - 32955314
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| || |||||| ||| || | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
32955228 |
gtgagtttagctcaattagtagggatattgcatgttgtatgcatgagtcgggattcgaacctcggacaccccacttctccacattta |
32955314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 161 - 242
Target Start/End: Original strand, 48950820 - 48950902
Alignment:
| Q |
161 |
attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
48950820 |
attatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctac |
48950902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 624483 - 624592
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||| ||| |||||||| | |||||||| || | |||||||||||| |||||||||||||||||||||| | |||||||| || |
|
|
| T |
624483 |
gtgagcttaactcagttggtaaggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccacatttaaaatgtgtgagct |
624582 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
||| |||||| |
|
|
| T |
624583 |
ctaaccacta |
624592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 13161756 - 13161864
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||| |||||||| |||||| |||||||| | || |||||||||||| ||||| |||||||| ||||||| | || ||||| |||||||| |
|
|
| T |
13161756 |
ttagctcagttggttgggatattacatattttatgcaggggtcggggttcgaaccccagacacaccacttct-cacatttaaaatttgtgagctctagcc |
13161854 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
13161855 |
actaggctac |
13161864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 120 - 214
Target Start/End: Original strand, 21116776 - 21116874
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgca----ggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| ||||| ||| |||||||| || | ||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21116776 |
ttatccccgtgagcttaactcagttgttaagaatattgcatattatatgcatgcaggggccgaggttcgaaccccggataccccacttctccacattta |
21116874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 30305801 - 30305917
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaac |
225 |
Q |
| |
|
||||| || |||||||||||| ||| | ||||| ||||||||||| || | ||||||||||||||||||| ||||||||||||||| | |||||||| | |
|
|
| T |
30305801 |
gtgagctttgctcagttggtatggacaaatgcattttatatgcaggggctggggttcgaaccccggacacctcacttctccacatttaaaatgtgtgagc |
30305900 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
30305901 |
tccagccactaggctac |
30305917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 122 - 190
Target Start/End: Original strand, 44602482 - 44602550
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
44602482 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaacccc |
44602550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 242
Target Start/End: Complemental strand, 23176780 - 23176674
Alignment:
| Q |
137 |
gctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||| | || |||||||||||||||||||||| |||||||||||| | |||||||| ||| |||||| |
|
|
| T |
23176780 |
gctcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaaccccggacacccca-ttctccacatttaaaatgtgtgagctccagccac |
23176682 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
23176681 |
taggctac |
23176674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 136 - 210
Target Start/End: Original strand, 29536120 - 29536195
Alignment:
| Q |
136 |
agctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc-ccacttctccaca |
210 |
Q |
| |
|
|||||||||||||| ||||| |||| ||||||||||| ||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
29536120 |
agctcagttggtagagatatcgcattttatatgcaggggccgaggttcgaaccccagacacctccacttctccaca |
29536195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 33530796 - 33530911
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||| | |||||||||||||||||||||||||| ||| || ||||||||||||||| || ||||||||||| ||| | ||||||| || |
|
|
| T |
33530796 |
gtgagcttagcttaattggtagggatattgcatattatatgtagggatcggggttcgaaccccggatactccacttctccataattgaattgtgtgagct |
33530895 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33530896 |
ctagccactaggctac |
33530911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 37719003 - 37719118
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||| ||||||||| |||| ||||||||||| | ||| |||||||| ||| |||| ||||||||||||| || | ||||||| || |
|
|
| T |
37719003 |
gtgagcttaactcagttgttagggatatcgcattttatatgcaggggtcgaagttcgaactccgaacactccacttctccacaagtaaattgtgtgagct |
37719102 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37719103 |
ctagccactaggctac |
37719118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 133 - 242
Target Start/End: Original strand, 12267526 - 12267636
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagc |
231 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| || |||| ||||||||||||||||||||||||| || || ||||||| ||||| | |
|
|
| T |
12267526 |
tttagctcagttggtagagatattgcatattatatgtaggggctagagttcaaaccccggacaccccacttctccacaatataattgtgtgagctctaac |
12267625 |
T |
 |
| Q |
232 |
cactaggctac |
242 |
Q |
| |
|
|||||| |||| |
|
|
| T |
12267626 |
cactagactac |
12267636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 236
Target Start/End: Complemental strand, 23778877 - 23778783
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | | |||||||||||| ||||||||||||||||||| ||| | ||||||| ||||| |||||| |
|
|
| T |
23778877 |
ttggtagggatattacatattatatgcaggggttggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagctctaaccacta |
23778783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 119 - 177
Target Start/End: Complemental strand, 23787415 - 23787357
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccg |
177 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23787415 |
tttatccctgtgagcataactcagttggtagggatattgcatattatatgcaggagccg |
23787357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 37868643 - 37868525
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||| ||||||| ||| || |||| |||| |||||||||||||||||||||| || | ||||||||| |||||||| |||||||||||| ||| | | |
|
|
| T |
37868643 |
tttatctctgtgagcttaacttagttagtagtgatattgcatattatatgcaggggctggagttcgaacctcggacacctcacttctccacaattaaatt |
37868544 |
T |
 |
| Q |
218 |
gtgtgaactctagccacta |
236 |
Q |
| |
|
|||||| ||||| |||||| |
|
|
| T |
37868543 |
gtgtgagctctaaccacta |
37868525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 151 - 223
Target Start/End: Original strand, 2275072 - 2275145
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacat-ttatatgtgtga |
223 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2275072 |
gatattgcatattatatgcagggatcgatgtttgaaccccggacaccccacttctccacatattatatgtgtga |
2275145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 9692968 - 9693037
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
9692968 |
tagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
9693037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 170 - 242
Target Start/End: Original strand, 10141028 - 10141101
Alignment:
| Q |
170 |
aggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
10141028 |
aggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagccactaggctac |
10141101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 207
Target Start/End: Original strand, 11091920 - 11092004
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
||||| |||||||| |||||||||||||| ||||| ||||||||||||| ||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
11091920 |
atccccgtgagttt-gctcagttggtaggaatattatatattatatgcagaagccggggttcgaatcccggacactccacttctcc |
11092004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 141 - 241
Target Start/End: Original strand, 19963798 - 19963899
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | || |||||||||| ||||||| |||||||| | ||||| ||||||| ||||||||| ||||| |
|
|
| T |
19963798 |
agttggtagggatattgcatattatatgcaggggtcggggttcgaacctcggacacttcacttctctgcaatttaattgtgtgagctctagccattaggc |
19963897 |
T |
 |
| Q |
240 |
ta |
241 |
Q |
| |
|
|| |
|
|
| T |
19963898 |
ta |
19963899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 20203429 - 20203538
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||||||||||||||||| |||||| ||| ||||||| |||||| | |||| ||| | | |||||| | |
|
|
| T |
20203429 |
gtgagcttagctcatttggtagagatattgcatattatatgcaggagccaaggttcaaacttcggacactccactttttcacaattaaattatgtgaatt |
20203528 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
20203529 |
ctagccacta |
20203538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 203
Target Start/End: Complemental strand, 26347139 - 26347058
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| ||||||||| ||||||| |||||||||||||| ||||||||| | |||| |||||||||||||||||||| |||| |
|
|
| T |
26347139 |
atccccgtgagtttaactcagttaatagggatattgcatgttatatgcaagggccggggttcgaaccccggacaccctactt |
26347058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 44312845 - 44312736
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| | || | |||||||||| |||| ||| ||||||||| ||| | ||||||| ||| ||| |
|
|
| T |
44312845 |
ttagctcagttggtagggatattgcattttatatgcaggggtcgggattcgaaccccaaacactccatttctccacaattaaattgtgtgagttcttgcc |
44312746 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
44312745 |
actaggctac |
44312736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 48825891 - 48825771
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||| ||||||||||||| | || |||||||||||||||| |||| ||||||||||||| |||| |||||||| ||| | |||| |
|
|
| T |
48825891 |
atccccgtgagcttaactcaattggtagggatatcgaattttatatgcaggagccggggttagaaccccggacactccac-tctccacaattaaattgtg |
48825793 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| ||||||| |||| |
|
|
| T |
48825792 |
tgagctctaaccactagactac |
48825771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 141 - 242
Target Start/End: Complemental strand, 53921561 - 53921460
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||| | || |||| ||||||||||||||||||||||||||||||| ||||||| || ||| |||||| || |
|
|
| T |
53921561 |
agttggtaggaatattgcatgttatatataggggtcggggtttgaaccccggacaccccacttctccacatttaactgtgtgagctatagtcactagact |
53921462 |
T |
 |
| Q |
241 |
ac |
242 |
Q |
| |
|
|| |
|
|
| T |
53921461 |
ac |
53921460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 10042474 - 10042370
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| || ||||||| ||||| || |||||| | |||| ||| | ||||||||||||| ||||||| |
|
|
| T |
10042474 |
tcagttggtagggatattgcatattatatgtaggagtcggagttcgaattccggatactccactttttcacaattaaattgtgtgaactctaaccactag |
10042375 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
10042374 |
gctac |
10042370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 241
Target Start/End: Complemental strand, 25726370 - 25726262
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | | | ||||||||||| ||||| |||||||||||| ||||| |||| || ||||| || |
|
|
| T |
25726370 |
ttagctcagttggtagggatattgcatattatatacaaggggcaaggttcgaaccttagacactccacttctccacaatttaattgtgcgagctctaacc |
25726271 |
T |
 |
| Q |
233 |
actaggcta |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
25726270 |
actaggcta |
25726262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 241
Target Start/End: Complemental strand, 27103162 - 27103054
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || | || ||||||| |||||||| ||||||||||||| ||| | ||||||| |||||| | |
|
|
| T |
27103162 |
ttagcttagttggtagggatattgcatattatatgtagaggtcggagttcgaattccggacactccacttctccacaattaaattgtgtgagctctagac |
27103063 |
T |
 |
| Q |
233 |
actaggcta |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
27103062 |
actaggcta |
27103054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 223
Target Start/End: Complemental strand, 29257060 - 29256960
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||| | ||||||| ||| ||||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
29257060 |
tccctgtgaggttagctcagttggcagagatattgcataatttatgcagcggccagagttcgaaccccagacaccccgcttctccacatttaattgtgtg |
29256961 |
T |
 |
| Q |
223 |
a |
223 |
Q |
| |
|
| |
|
|
| T |
29256960 |
a |
29256960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 137 - 240
Target Start/End: Complemental strand, 41137978 - 41137874
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||| | | |||||||||| | |||||||||||||| || |||| | |||| ||| ||||||||||| |
|
|
| T |
41137978 |
gctcagttggtagggacattgcataatatatgcaggggttggggttcgaaccacagacaccccacttcttcatatttaaaatgtttgagctctagccact |
41137879 |
T |
 |
| Q |
236 |
aggct |
240 |
Q |
| |
|
||||| |
|
|
| T |
41137878 |
aggct |
41137874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 143 - 242
Target Start/End: Original strand, 41854151 - 41854251
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| |||| |||||||| |||||| | ||||||||||| ||| | ||||||| ||| ||||||||| ||| |
|
|
| T |
41854151 |
ttggtagggatattgcatatgatatgtaggagctgaggatcgaaccctggacactcaacttctccacaattaaattgtgtgagctccagccactagacta |
41854250 |
T |
 |
| Q |
242 |
c |
242 |
Q |
| |
|
| |
|
|
| T |
41854251 |
c |
41854251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 238
Target Start/End: Original strand, 20320729 - 20320828
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
||||||||| |||||| | |||||||||||||| ||| | ||| ||||||||||||| ||||||| |||| ||||| |||||||||||| ||||||||| |
|
|
| T |
20320729 |
cagttggtaaggatatcggatattatatgcaggggccaaagtttgaaccccggacactccacttcaccacaatttaattgtgtgaactctggccactagg |
20320828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 156 - 242
Target Start/End: Original strand, 28715721 - 28715808
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||||||||||| |||||||||||||||| | |||||||| || ||||||||| |||| |
|
|
| T |
28715721 |
tgcattttatatgcaggggccggggttcgaaccccggacactccacttctccacatttaaaatgtgtgagcttcagccactagactac |
28715808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 238
Target Start/End: Original strand, 32293106 - 32293221
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| |||||||||||| || ||| |||||||| | |||||||| | || |||| |||||| ||||| ||||||||||||||||| | |||| |
|
|
| T |
32293106 |
tccccgtgagcttagctcagttgataaggacattgcataatttatgcaggggtcggggttagaaccctggacattccacttctccacatttaattatgtg |
32293205 |
T |
 |
| Q |
223 |
aactctagccactagg |
238 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
32293206 |
agctctagccactagg |
32293221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 34040431 - 34040546
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||| ||| ||||||||| ||||||| ||| | | ||||||||| |||||||| ||||||||||| | ||||| ||||||| | |
|
|
| T |
34040431 |
gtgagcttagctcagttgatagaaatattgcattttatatgtaggggtcagggttcgaactccggacactccacttctccataattatattgtgtgagtt |
34040530 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34040531 |
ctagccactaggctac |
34040546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 38690666 - 38690741
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| ||||||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
38690666 |
tgagcttagctcacttggtaagggataatgcatattatatgcaggggtcggggttcgaaccccggacaccccactt |
38690741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 4105730 - 4105812
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||||||||| ||| | ||||||||| |||||| ||||||||||||| |
|
|
| T |
4105730 |
gtgagcttagctcagttgatagggatattgcattttatatgcagagaccgggattcgaaccctggacactccacttctccaca |
4105812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 129 - 223
Target Start/End: Complemental strand, 21863951 - 21863857
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||| |||||| |||||||||| |||||||||| | |||||| ||||| ||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
21863951 |
tgagcttagcttagttggtaggaatattgcataatttatgcaaaagccgtggttcgaacatcggacaccccacttctccacttttaattgtgtga |
21863857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 129 - 223
Target Start/End: Complemental strand, 21919812 - 21919718
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||| |||||| |||||||||| |||||||||| | |||||| ||||| ||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
21919812 |
tgagcttagcttagttggtaggaatattgcataatttatgcaaaagccgtggttcgaacatcggacaccccacttctccacttttaattgtgtga |
21919718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 145 - 203
Target Start/End: Original strand, 22819428 - 22819486
Alignment:
| Q |
145 |
ggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||| ||||| |||||| |
|
|
| T |
22819428 |
ggtagggatattgcatattatatgcaggagctggggttcgaaccccagacactccactt |
22819486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 29505811 - 29505693
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
||||| || ||||| ||| || ||||||||||||||| ||| |||||||||| |||| |||||||| ||||||||| ||||||||| ||| ||| | | |
|
|
| T |
29505811 |
tttattcccgtgagcttaacttagttggtagggatatcacattttatatgcagaggccggggttcgaatcccggacactccacttctcgacaattaaatt |
29505712 |
T |
 |
| Q |
218 |
gtgtgaactctagccacta |
236 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
29505711 |
gtgtgagctctagccacta |
29505693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 34932498 - 34932608
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| ||||||| ||| | || |||||||||||| |||||| ||||||||||| ||| | ||| ||| || |
|
|
| T |
34932498 |
gtgagcttagctcagttggtaggaatattgcacgttatatgtaggggtcggggttcgaaccccaaacaccctacttctccacaattaaattgtatgagct |
34932597 |
T |
 |
| Q |
227 |
ctagccactag |
237 |
Q |
| |
|
||||||||||| |
|
|
| T |
34932598 |
ctagccactag |
34932608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 35207218 - 35207136
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||||||||||||||||| | ||||||| ||||||||| | ||||||||||| |
|
|
| T |
35207218 |
gtgagcttaactcagttgatagggatattgcatattatatgcaggagtcagggttcgagtcccggacactctacttctccaca |
35207136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 117 - 234
Target Start/End: Original strand, 42073151 - 42073268
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||| |||||||||| ||||||| ||| ||| |||||||||||||||||| ||| || |||||| ||| | |
|
|
| T |
42073151 |
aatttatccccgtgaacttagctcacttggtagagatattgcattttatatgtagggtccg-ggttcgaaccccggacactccatttttccacaattaaa |
42073249 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccac |
234 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
42073250 |
ttgtgtgagctctagccac |
42073268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 242
Target Start/End: Original strand, 42663980 - 42664098
Alignment:
| Q |
124 |
ccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||| |||||||| ||| || ||| |||||||| | || |||| | | |||||||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
42663980 |
ccctgtgagcttagctcaattgatatggacattgcataatttacgcagaggttggggttcgaatcctggacaccccacttctccacatttaattgtgtga |
42664079 |
T |
 |
| Q |
224 |
actctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
42664080 |
gctctagccactagactac |
42664098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 121 - 203
Target Start/End: Complemental strand, 55238573 - 55238491
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| ||||| |||||| |||||||||||||||||||||||||||||||| |||| |||| ||| | || |||| |||||| |
|
|
| T |
55238573 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatgcaggggccggggtttgaatctcgaacactccactt |
55238491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 55260380 - 55260294
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| |||||| |||||||||||| |||||||| | |||| ||| || |||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
55260380 |
gtgagcttagcttagttggtagggacattgcataatttatgtaggggcagaggttcgaacctctgacactccacttctccacattta |
55260294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 128 - 209
Target Start/End: Original strand, 2771039 - 2771120
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
||||| ||||||||| || || ||||||||||||||||||||||| ||| |||||||||||| |||||| |||||||||| |
|
|
| T |
2771039 |
gtgagcttagctcagctgatatggatattgcatattatatgcagggaccggagttcgaaccccgaacaccctacttctccac |
2771120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 4357891 - 4358000
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| ||| ||| | || |||||| |||||| |||||||||||| ||||| | | ||| |||||||| |
|
|
| T |
4357891 |
ttagctcagttggtagagatattgtatattatatgtaggggccatgatttgaaccctggacactccacttctccacaatttaattctatgagctctagcc |
4357990 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
4357991 |
actaggctac |
4358000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 230
Target Start/End: Complemental strand, 8089312 - 8089215
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctag |
230 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||||| | || |||||||| ||||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
8089312 |
ttagttcagttggtaaagacattgcatattatatgcaggggtcggagttcgaacttcggacactccatttctccacatttaatatgtgtgaactctag |
8089215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 235
Target Start/End: Complemental strand, 8144652 - 8144551
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||| || | ||||||||||| | ||| || | ||||||||||||||||||| |||||| || |
|
|
| T |
8144652 |
ttagctcagtttgtagggatattgcatattatatgtaggggctggggttcgaacccagaacatttcattagtccacatttatatgtgtgagctctagtca |
8144553 |
T |
 |
| Q |
234 |
ct |
235 |
Q |
| |
|
|| |
|
|
| T |
8144552 |
ct |
8144551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 128 - 201
Target Start/End: Original strand, 9661553 - 9661626
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||| | ||| || ||||||||||||||||| |||| |
|
|
| T |
9661553 |
gtgagtttatctcagttggtatggatattgcatattatatgtaagagtcggagttcgaaccccggacactccac |
9661626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 125 - 242
Target Start/End: Complemental strand, 10407104 - 10406981
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggt------tcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||| |||||| ||||| |||||| |||| | ||||||||||||| ||| | | |
|
|
| T |
10407104 |
cctgtgagcttagctcagttggtagg-atattgcatattatatgtaggagctgaggtctcggctcgaacatcggatattccacttctccacaattaaatt |
10407006 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
10407005 |
gtgtgagctctagccactaggctac |
10406981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 12678511 - 12678596
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| || | |||||| ||| |||||||||||| |||||||||| |
|
|
| T |
12678511 |
tgagtttgactcagttggtagagatattgcatattatatgcaggggctggaattcgaaacccagacaccccacttatccacattta |
12678596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 14149799 - 14149868
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
14149799 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
14149868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 135 - 210
Target Start/End: Complemental strand, 27743768 - 27743700
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
27743768 |
tagctcagttggtagggatattgcatattatatgcag-------gggtcgaaccccggacaccctacttctccaca |
27743700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 28520820 - 28520751
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
28520820 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
28520751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 32339337 - 32339442
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | | || ||||| |||||| |||||||||||||| ||||| | |||| ||| ||||||||| || |
|
|
| T |
32339337 |
ctcagttgttagggatattgcatattatatgcaagggtcggggttcaaaccccagacaccccacttctttgcatttaaaatgtctgagctctagccatta |
32339436 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
32339437 |
ggctac |
32339442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 35465432 - 35465553
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| |||||| |||| | |||||||| ||||||||||||||||||| ||| | ||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggatattgcattttatatacaggggttagggttcgaattttagacaccccacttctccacaattaaattgta |
35465531 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
35465532 |
tgagctctagccactaggctac |
35465553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 52757352 - 52757263
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||| ||||||||||||| ||| ||||||||||||||||||||| | | ||||||||| | ||||||||| ||||||||| |
|
|
| T |
52757352 |
tatccccgtgagcttagctcagttggcaggaatattgcatattatatgcaggggttggggttcgaacttcagacaccccatttctccaca |
52757263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 12775299 - 12775191
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| | | |||||||| | |||||| ||||||||||||| ||| | ||||||| || || ||| |
|
|
| T |
12775299 |
tagctcagttggtagggatattgcattttatatgcaggggtcagggttcgaattctggacactccacttctccacaattaaattgtgtgagctttaccca |
12775200 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
12775199 |
ctagactac |
12775191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 23142821 - 23142705
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaac |
225 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||| ||||||| ||| || | |||||||||| ||||| |||| |||||||||||| | |||||||| | |
|
|
| T |
23142821 |
gtgagcttagctcagttggtagggacaaatgcattttatatgtaggggctggggttcgaacctcggaccgcccatttctccacatttaaaatgtgtgagc |
23142722 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
23142721 |
tccagccactaggctac |
23142705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 40809253 - 40809134
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcag-gagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||| | ||||||| || | || ||| |||||||||||| |||||||||||||| ||| | ||| |
|
|
| T |
40809253 |
tccctgtgagcttagttcagttggtagggatattgtataatttatgcagagatcgga-gtttgaaccccggacatcccacttctccacaattaattatgt |
40809155 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| ||||||||| || ||||| |
|
|
| T |
40809154 |
gagctctagccattacgctac |
40809134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 229
Target Start/End: Original strand, 43863783 - 43863891
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||| |||||| ||| |||| ||||||||||| | |||||||||||||| | | | |||||||||||||||| |||| ||||||||| ||| | ||||| |
|
|
| T |
43863783 |
tatctctgtgaacttaactcaattggtagggatctcgcatattatatgcaagggtctaggttcgaaccccggataccctacttctccatattaaaatgtg |
43863882 |
T |
 |
| Q |
221 |
tgaactcta |
229 |
Q |
| |
|
||| ||||| |
|
|
| T |
43863883 |
tgagctcta |
43863891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 54029567 - 54029671
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||| || |||||| ||||||||||| ||| ||| ||||||| ||||||||| ||||||||||||| ||| | ||||||| |||||| |||||| |
|
|
| T |
54029567 |
tcagttggcagagatattacatattatatgtagggaccggagttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagtcactag |
54029666 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
54029667 |
gctac |
54029671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 201
Target Start/End: Original strand, 1439627 - 1439694
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| | | || |||||||||||| |||||||||| |
|
|
| T |
1439627 |
ttagctcagttggtatggacattgcatattatatgcaagggtcggggttcgaaccccagacaccccac |
1439694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 6584049 - 6584103
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
6584049 |
agggatattgcatattatatgcaggagccga-gttcgaacctcggacacccgactt |
6584103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 6930554 - 6930629
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||| |||||||||| |||| | ||| ||| ||||||||||||||| |
|
|
| T |
6930554 |
gtgagattagctcagctgctagggatattgcataatatatgcaggggccgggattcaaactccggacaccccactt |
6930629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 235
Target Start/End: Complemental strand, 9477503 - 9477396
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||||||||||| || ||||| ||| || |||||||||||| | |||||| | |||||||| ||| |
|
|
| T |
9477503 |
gtgagtttaactcaattggttaagatattgcatattatatgcagggatcgtggttcaaactccagacaccccacttattcacattaaaatgtgtgagctc |
9477404 |
T |
 |
| Q |
228 |
tagccact |
235 |
Q |
| |
|
|||||||| |
|
|
| T |
9477403 |
tagccact |
9477396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 205
Target Start/End: Original strand, 12763765 - 12763836
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| | ||||||| | |||||||||| |||||||| |
|
|
| T |
12763765 |
ttagctcagttgctagggatattgcatattatatacaggggttgaggttcaagccccggacactccacttct |
12763836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 13564335 - 13564220
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| ||||||||| | | |||||||||| | ||||| |||||||| ||| ||||| ||||||| || |
|
|
| T |
13564335 |
gtgagtttagcttagttagtatggatattgcattttatatgcatgggataaggttcgaacatcagacactccacttctacacaatttaattgtgtgagct |
13564236 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
13564235 |
ctagccactaggctac |
13564220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 21432617 - 21432732
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
||||| |||| ||||||||||| ||||||||||||||||| ||| | || || |||||||| ||| |||||| ||||||| |||| | |||||||| || |
|
|
| T |
21432617 |
gtgagcttagttcagttggtagagatattgcatattatatacagaggtcggggatcgaaccctggataccccatttctccatatttaaaatgtgtgagct |
21432716 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| | |||||||||| |
|
|
| T |
21432717 |
ctaactactaggctac |
21432732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 144 - 223
Target Start/End: Original strand, 25224491 - 25224570
Alignment:
| Q |
144 |
tggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||| |||||||| | |||||||| | || ||||||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
25224491 |
tggtagggacattgcataatttatgcaggggtcggagttcgaacctcggacaccccacttcttcatatttatatgtgtga |
25224570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 242
Target Start/End: Original strand, 28815615 - 28815729
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca-ccccacttctccacatttatatgtgtgaa |
224 |
Q |
| |
|
||||||| |||||| |||||||||| |||||||| || ||||||| |||| | |||||||| | |||| ||||||||||||||||| | |||||||| |
|
|
| T |
28815615 |
ctgtgagcttagcttagttggtaggaatattgcacat---atgcaggggccgggattcgaacctcagacatccccacttctccacattaaaatgtgtgag |
28815711 |
T |
 |
| Q |
225 |
ctctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||| |||| |
|
|
| T |
28815712 |
ctctaaccactagactac |
28815729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 37310030 - 37310145
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||| ||| | | ||||| ||||||| ||| ||||||||| || | ||| | |||||||| | |
|
|
| T |
37310030 |
gtgagtttaactcagttggtatggatattgcatattatatgtaggggttggggttcaaaccccgtacatcccacttcttcataattaaattgtgtgaatt |
37310129 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| ||||||| |||| |
|
|
| T |
37310130 |
ctaaccactagactac |
37310145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 42334131 - 42334016
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||| | ||| || |||||||| | ||||||| |||||||| |||||||||||||||| ||||||||||| | ||| | ||||||| || |
|
|
| T |
42334131 |
gtgagcttagcttaattgttatggatattgtgttttatatgtaggagccggaattcgaaccccggacactccacttctccataattaaattgtgtgagct |
42334032 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42334031 |
ctagccactaggctac |
42334016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 44568263 - 44568172
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||| | || ||||||||| | |||||| |||||||||| ||||| ||||||| ||| ||||||||| |||| |
|
|
| T |
44568263 |
gatattgcatattatatgcaggggtcggggttcgaactcgagacacctcacttctccatatttaattgtgtgagctcaagccactagactac |
44568172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 209
Target Start/End: Complemental strand, 54103637 - 54103550
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
||||| ||| ||||| |||||||| |||||||||||||||||||||||||| | | |||||||||||||| | | ||||||||||| |
|
|
| T |
54103637 |
atccccgtgcgtttaactcagttgatagggatattgcatattatatgcaggggttggagttcgaaccccggatatctcacttctccac |
54103550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 186
Target Start/End: Complemental strand, 39697929 - 39697871
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa |
186 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||| | || |||||||| |
|
|
| T |
39697929 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggggtcggggttcgaa |
39697871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 237
Target Start/End: Original strand, 42081737 - 42081847
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||| |||| |||||||| || ||||||||||| | |||| ||| || | |||||||| | |||||| ||||||||||||||||| ||||||| || |
|
|
| T |
42081737 |
tgtgagcttagttcagttggcagagatattgcataatttatgtaggggctggggttcgaatcttggacactccacttctccacatttaattgtgtgagct |
42081836 |
T |
 |
| Q |
227 |
ctagccactag |
237 |
Q |
| |
|
||| ||||||| |
|
|
| T |
42081837 |
ctacccactag |
42081847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 123 - 232
Target Start/End: Original strand, 43539810 - 43539920
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgt |
221 |
Q |
| |
|
|||| ||||| |||| |||||||||||||| | | |||| |||||| ||| || |||||||||| | |||||||||||||||||||||| | |||||| |
|
|
| T |
43539810 |
tccccgtgagcttagttcagttggtagggacaatacataatatatgtaggggctgaggttcgaattctagacaccccacttctccacatttaaaatgtgt |
43539909 |
T |
 |
| Q |
222 |
gaactctagcc |
232 |
Q |
| |
|
||||| ||||| |
|
|
| T |
43539910 |
gaactttagcc |
43539920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 43627328 - 43627214
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
|||||||||| ||||||| || || |||||||| | |||||||| | || ||||| ||||| |||||| ||||||||||| ||||| ||||||| ||| |
|
|
| T |
43627328 |
gtgagtttagttcagttgatatagacattgcataatttatgcaggggtcggggttcaaaccctggacactccacttctccatatttaattgtgtgagctc |
43627229 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||| ||||| |||| |
|
|
| T |
43627228 |
tagctactagactac |
43627214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 123 - 241
Target Start/End: Original strand, 52015489 - 52015606
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||| |||||||| | |||||| | || |||||||||| |||||||| ||||| |||||| |||| |||| | |
|
|
| T |
52015489 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcaagggctgaggttcgaa-tccggacactccactcctccacgtttaattgtgcg |
52015587 |
T |
 |
| Q |
223 |
aactctagccactaggcta |
241 |
Q |
| |
|
| ||||| ||||||||||| |
|
|
| T |
52015588 |
agctctaaccactaggcta |
52015606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 120 - 210
Target Start/End: Complemental strand, 52483251 - 52483162
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| || |||||||||||||| |||||| | |||| |||| ||||| | ||||||||||||| |
|
|
| T |
52483251 |
ttatccccgtgagcttagctcagttggtagg-atgttgcatattatatgtaggagcaggggtttgaacaccggatgctccacttctccaca |
52483162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 189
Target Start/End: Complemental strand, 56360788 - 56360718
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccc |
189 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||| ||||||||| ||| | | ||||||||||| |
|
|
| T |
56360788 |
tttatccccgtgaatttagctcagttggtagggatattgcgtattatatgtaggggtcagggttcgaaccc |
56360718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 214
Target Start/End: Complemental strand, 922321 - 922228
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgag-gttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| || ||||||||||||||||||| | ||||||||||||||| || | ||||| || |||||||| ||||| |||||||||||||||| |
|
|
| T |
922321 |
atccccgtaagtttagctcagttggtagaggtattgcatattatatacaaggtccgagattttgaaccccgaacacctcacttctccacattta |
922228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 42411543 - 42411474
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | |||||| ||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
42411543 |
tagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccactt |
42411474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 47018034 - 47017966
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
47018034 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
47017966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 139 - 203
Target Start/End: Complemental strand, 48968295 - 48968230
Alignment:
| Q |
139 |
tcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
48968295 |
tcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
48968230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 53815702 - 53815771
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
53815702 |
tagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccactt |
53815771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 214
Target Start/End: Complemental strand, 7513454 - 7513362
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | || || ||||||||||| | | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7513454 |
tccccgtgagctttgctcagttggtagggacaaatgtattttatatgcaggggtcagggttcgaaccccggacactccacttctccacattta |
7513362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 13551009 - 13551089
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| | || | ||||||||||| ||| |||||||| |||||||| |
|
|
| T |
13551009 |
ttagttcagttggtagggatatcacatattatatgcaggtgtcgtgtttcgaaccccgaacattccacttcttcacattta |
13551089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 242
Target Start/End: Original strand, 32760679 - 32760759
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| | | ||||||||| |||||||||||| ||||||||| ||| |||||||| |||||||||||| |||| |
|
|
| T |
32760679 |
ttatatgcaggggttggggttcgaactccggacaccccatttctccacaattaattgtgtgaattctagccactagactac |
32760759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 33107365 - 33107441
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| || |||| ||||||| |||| |||| ||||||||||||| |
|
|
| T |
33107365 |
ttagctcagttggtaaggatattgtatattatatgtgggggccggagttcgaatcccgaacactccacttctccaca |
33107441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 127 - 195
Target Start/End: Original strand, 46206579 - 46206647
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||| |||||||||| | || | ||||||||||||||| |
|
|
| T |
46206579 |
tgtgagcttagctcagttggtagggacattgcattatatatgcaggggtcgggattcgaaccccggaca |
46206647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 205
Target Start/End: Original strand, 49022958 - 49023042
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||||||||||||| ||| | | || |||||||| |||||||||||||||||| |
|
|
| T |
49022958 |
tatccctgtgaacttaactcagttggtaggaatattgcatattagatgtggaggtcggggttcgaatcccggacaccccacttct |
49023042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 122 - 170
Target Start/End: Complemental strand, 50442814 - 50442766
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
50442814 |
atccctgtgagcttagctcagttggtagggataatgcataatatatgca |
50442766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 54443941 - 54443865
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||| || ||||||| | |||||||||||||||||||| |
|
|
| T |
54443941 |
ttagcttaggtggtagggatattgcatattatatgcaggggctagtattcgaactctggacaccccacttctccaca |
54443865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 3157291 - 3157240
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||| |||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3157291 |
tatccccgtgaacttagctcagttggtaggaatattgcatattatatgcagg |
3157240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 233
Target Start/End: Complemental strand, 10010439 - 10010332
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||||||| |||||||| || |||| |||||||||||||| ||||| | |||||||||| | ||||| | || |||||||| ||| | ||||||| | |
|
|
| T |
10010439 |
tgtgagtttaactcagttgataaggatgttgcatattatatgaaggagtcatggttcgaacctcagacactcaacgtctccacaattaaattgtgtgagc |
10010340 |
T |
 |
| Q |
226 |
tctagcca |
233 |
Q |
| |
|
|||||||| |
|
|
| T |
10010339 |
tctagcca |
10010332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 17447256 - 17447141
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||| |||||||||||||| || ||||||||||||| | ||||||||| | |||||| ||| |||| |||| ||| | ||||||| | |
|
|
| T |
17447256 |
gtgagcttagctcggttggtagggatatcacactttatatgcaggagttggggttcgaactctggacactccatttcttcacaattaaattgtgtgagtt |
17447157 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17447156 |
ctagccactaggctac |
17447141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 19594236 - 19594351
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||| ||| |||||||||||||||||| ||| ||| ||||||||||| |||| ||| || ||||| |||||| ||||||| || |
|
|
| T |
19594236 |
gtgagcttaactcagttgatagagatattgcatattatatgtaggggccagggttcgaaccctagacattccatttttccacaatttatttgtgtgagct |
19594335 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||| |
|
|
| T |
19594336 |
ctaaccaataggctac |
19594351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 135 - 186
Target Start/End: Complemental strand, 19933860 - 19933809
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa |
186 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
19933860 |
tagctcagttggtagggataatgcatattatatgttggggccgaggttcgaa |
19933809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 214
Target Start/End: Original strand, 23695138 - 23695173
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23695138 |
ggttcgaaccccggacaccccacttctccacattta |
23695173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 25175200 - 25175153
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
25175200 |
cctgtgagcttagttcagttggtagggatattacatattatatgcagg |
25175153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 223
Target Start/End: Original strand, 30263763 - 30263858
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||| ||| ||||||||||| ||| |||| ||| || || || | |||| ||||| |||| ||||||||| ||||||||||||||| |||||||| |
|
|
| T |
30263763 |
gtgagcttatctcagttggtaaggacattgtataatacatacaagggccggggttcaaacctcggacacccaacttctccacatttaaatgtgtga |
30263858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 30288424 - 30288329
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||| ||| ||||||||||| ||| |||| ||| || || || | |||| ||||| |||| ||||||||| ||||||||||||||| |||||||| |
|
|
| T |
30288424 |
gtgagcttatctcagttggtaaggacattgtataatacatacaagggccggggttcaaacctcggacacccaacttctccacatttaaatgtgtga |
30288329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 31601838 - 31601881
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
31601838 |
tattatatgcaggggccgagattcgaaccccggacaccccactt |
31601881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 34773746 - 34773703
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
34773746 |
tattatatgcaggggctgaggttcgaaccccggacaccccactt |
34773703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 201
Target Start/End: Original strand, 37728934 - 37729012
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| |||| |||||||||||| | |||||||||||| |||||||| |||| |
|
|
| T |
37728934 |
tccctgtgagcatagttcagttggtagggatat-gcattattatatgcaggggtcgaggttcgaactccggacactccac |
37729012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 210
Target Start/End: Complemental strand, 44195680 - 44195610
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| | || |||||||| |||||||| |||||||||||| |
|
|
| T |
44195680 |
tcagttggtagggatattgcattttatatgcagg-gtcggggttcgaattccggacacttcacttctccaca |
44195610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 45673649 - 45673763
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||| ||||||||||||||||||||| | |||||||||||| || || |||||||| ||| ||| | |||| |
|
|
| T |
45673649 |
atccccgtgagcttaactcagttggtaggaatattgcatattatatgcagggattggggttcgaacccc-gatacttcacttctcaacaattaaattgtg |
45673747 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
45673748 |
tgagctctagccacta |
45673763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 236
Target Start/End: Complemental strand, 49634403 - 49634318
Alignment:
| Q |
154 |
attgcatattatatgcaggagc---cgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| |||||||||||| ||| ||||| | |||||||||||| |
|
|
| T |
49634403 |
attgcatattatatgcaggagcaagcagggttcgaaccccggacacttcacttctccacaattaattgtgtaagctctagccacta |
49634318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 51759715 - 51759612
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||||||||| |||| || | ||| ||| || ||||||||||||||||||| | |||| ||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
51759715 |
tcagttggtagggacattgtattatttataaaggggctgaggttcgaaccccggacatctcactgctccatatttaattgtgtgagctctagccactaga |
51759616 |
T |
 |
| Q |
239 |
ctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
51759615 |
ctac |
51759612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 53698043 - 53698000
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
53698043 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
53698000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 242
Target Start/End: Original strand, 54215769 - 54215879
Alignment:
| Q |
133 |
tttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctag |
230 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||| ||| | | |||||||||||| |||||||||||||||||||||| | || ||||| |||||| |
|
|
| T |
54215769 |
tttagctcagttggtagggataaatacattttatatgtaggggtgg-ggttcgaaccccagacaccccacttctccacatttaaaatatgtgagctctag |
54215867 |
T |
 |
| Q |
231 |
ccactaggctac |
242 |
Q |
| |
|
||| ||| |||| |
|
|
| T |
54215868 |
ccattagactac |
54215879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 121 - 203
Target Start/End: Original strand, 1332897 - 1332978
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| | || |||||||| |||||||||| |||||||| |||||||| | || ||| |||||||||| |||||||||||| |
|
|
| T |
1332897 |
tatccctataagcttagctcaattggtagggacattgcataatatatgcaagggctgag-ttcgaaccccagacaccccactt |
1332978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 9735198 - 9735083
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata---tgtgtgaac |
225 |
Q |
| |
|
|||| |||||||||||||||||||||| | || |||||| |||||| || |||||||| || ||||| || |||||||||| ||||| ||||| | | |
|
|
| T |
9735198 |
tgagcttagctcagttggtagggatatcgtattttatatctaggagcgga-gttcgaactccagacactccgcttctccacaattataaattgtgtaagc |
9735100 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
9735099 |
tctaaccactaggctac |
9735083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 223
Target Start/End: Complemental strand, 9765037 - 9764995
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
9765037 |
ttcgaaccccggacaccctacttctccacatttaaatgtgtga |
9764995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 242
Target Start/End: Complemental strand, 17709494 - 17709412
Alignment:
| Q |
161 |
attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||||| ||||||||| ||| ||| | ||||||| |||||| ||||||||||| |
|
|
| T |
17709494 |
attatatgtaggggccggagttcgaaccccggacactccacttctctacaattaaattgtgtgagctctagtcactaggctac |
17709412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 18002327 - 18002409
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||| | ||| ||||||||| |||| ||||||| ||| | |||||||||||||||||||| |||||||| |||| |
|
|
| T |
18002327 |
gtgagcttagcttaattgatagggatatcgcattttatatgtaggggttgaggttcgaaccccggacactccacttcttcaca |
18002409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #259
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 197
Target Start/End: Original strand, 19854564 - 19854634
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||||| ||||||||||||||| ||| | |||||| |||||||| || ||| |||||||||| |||||||| |
|
|
| T |
19854564 |
tgtgagcttagctcagttggtatggacaatgcataatatatgcaagatccggggttcgaacctcggacacc |
19854634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #260
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 138 - 236
Target Start/End: Original strand, 24704142 - 24704239
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||| |||||||| | |||||||| | |||||||| | || |||||||||| |||||| | ||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
24704142 |
ctcaattggtaggaacattgcataatttatgcaggggtcggagttcgaaccctggacactc-acttctccacatttaattgtgcgaactctagccacta |
24704239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #261
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 138 - 196
Target Start/End: Original strand, 26250660 - 26250718
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||| |||| |||||||| ||||||||| |
|
|
| T |
26250660 |
ctcagttggtagggacattgcataatttatgcaggggccggggttcgaatcccggacac |
26250718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #262
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 29584648 - 29584721
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||| ||| | |||||||| | |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
29584648 |
tgagcttagctcaattggcagg-acattgcataatttatgcaggggccgaggttcgaaccccggacacctcactt |
29584721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #263
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 31016348 - 31016453
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| | ||||| || ||||||||| ||||||||||| ||| | ||||||| ||||||||||| |
|
|
| T |
31016348 |
gctcagttggtagggatattgcatattatatgtagggatcaaggtt-taaacccggacacttcacttctccacaattgaattgtgtgagctctagccact |
31016446 |
T |
 |
| Q |
236 |
aggctac |
242 |
Q |
| |
|
| ||||| |
|
|
| T |
31016447 |
atgctac |
31016453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #264
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 184 - 242
Target Start/End: Original strand, 44040418 - 44040476
Alignment:
| Q |
184 |
gaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||| || || ||||||| ||||| |||||||||||| |
|
|
| T |
44040418 |
gaaccccggacaccccacttctccatatataattgtgtgagctctatccactaggctac |
44040476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #265
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 161 - 242
Target Start/End: Complemental strand, 44224521 - 44224439
Alignment:
| Q |
161 |
attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| ||| ||||||||||||||| | ||||||||||||||||||| ||| | |||| || | ||||||||||||||| |
|
|
| T |
44224521 |
attatatgtaggggccgaggttcgaacctcagacaccccacttctccacaattaaattgtgggagttttagccactaggctac |
44224439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #266
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 132 - 242
Target Start/End: Complemental strand, 46791271 - 46791161
Alignment:
| Q |
132 |
gtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagc |
231 |
Q |
| |
|
|||||||||| |||||| | |||| ||| | |||||||||| | ||||||||| ||||||||||||||||| |||||||| | ||||| || ||| |
|
|
| T |
46791271 |
gtttagctcaattggtaaaaacattgtataatttatgcaggagatggggttcgaactccggacaccccacttcttcacatttaattctgtgagcttcagc |
46791172 |
T |
 |
| Q |
232 |
cactaggctac |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
46791171 |
cactaggctac |
46791161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #267
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 52699192 - 52699306
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||| |||| | | ||||||||| | |||| ||||| |||||| ||||| |||||||| || |
|
|
| T |
52699192 |
gtgagtttaactcagttgataggaatattgcatattatatacaggggttggagttcgaacctcagacatcccacctctccatatttaattgtgtgaattc |
52699291 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
| |||| ||| |||| |
|
|
| T |
52699292 |
tggccaatagactac |
52699306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #268
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 8690220 - 8690289
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| | ||| | ||||| |||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
8690220 |
tagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccactt |
8690289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #269
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 203
Target Start/End: Original strand, 22525411 - 22525463
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| |||||||||||||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
22525411 |
ggataatgcatattatatgcagaagccg-ggttcgaatcccggacaccccactt |
22525463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #270
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 242
Target Start/End: Original strand, 29759570 - 29759631
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||| ||| ||||||||||||||||| |
|
|
| T |
29759570 |
ttcgaaccccggacatcccacttctccacatataattgtatgagttctagccactaggctac |
29759631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #271
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 212
Target Start/End: Complemental strand, 32005641 - 32005608
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32005641 |
ggttcgaaccccggacaccccacttctccacatt |
32005608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #272
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 36008281 - 36008350
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| ||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
36008281 |
tagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccactt |
36008350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #273
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 167
Target Start/End: Complemental strand, 37700672 - 37700627
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
37700672 |
atccccgtgagtttacctcggttggtagggatattgcatattatat |
37700627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #274
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 236
Target Start/End: Complemental strand, 41442970 - 41442873
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtgaactctagccacta |
236 |
Q |
| |
|
|||||| ||| ||||||| ||||||||| |||| | || | |||||||||| |||||| ||||||| |||| ||| || |||||||||||| |||||| |
|
|
| T |
41442970 |
cagttgatagagatattgtatattatatacaggggtcgggattcgaaccccagacacctcacttcttcacaattaaattgtgtgaactctacccacta |
41442873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #275
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 214
Target Start/End: Original strand, 43512442 - 43512515
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || | |||| ||||| | |||||||| |||| |||||||| |
|
|
| T |
43512442 |
agttggtaggaatattgcatattatatgcaggggctggagttcaaacccggaacaccccatttcttcacattta |
43512515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #276
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 212
Target Start/End: Complemental strand, 45665099 - 45665014
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||| |||||||||| ||| ||||||||||| ||| |||||||||||||||| |
|
|
| T |
45665099 |
gtgaatttagctcagttggtagggacaaatgcataatatatgcagggaccggtgttcgaaccccaaacatcccacttctccacatt |
45665014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #277
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 49315994 - 49316109
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca--tttatatgtgtgaac |
225 |
Q |
| |
|
||||| ||| |||||||| || |||||||| |||||||| |||| || |||||||||||| | |||| ||||||||||||| |||| ||||||| | |
|
|
| T |
49315994 |
gtgagcttaactcagttgataaggatattgtatattatacgcag-aggttaggttcgaaccctgaacactccacttctccacaattttaattgtgtgagc |
49316092 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
49316093 |
tctagtcactaggctac |
49316109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #278
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Complemental strand, 56531337 - 56531256
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| |||||||||||| | ||| | ||||| ||||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
56531337 |
tccctgtgagcatagctcagttggcaaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccccactt |
56531256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #279
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 201
Target Start/End: Original strand, 14944471 - 14944539
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||| ||| || |||||||||||||||||| |||||| |||||| |||||| |||||| |||| |
|
|
| T |
14944471 |
tttagctcaattgataaggatattgcatattatatacaggagttgaggtttgaaccctggacactccac |
14944539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #280
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 208
Target Start/End: Complemental strand, 17683962 - 17683882
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| ||| ||||||| |||||||||||| || ||||||||||| |||| |||| || ||||||||| |||||||||| |
|
|
| T |
17683962 |
gtgagcttaactcagttagtagggatattggattttatatgcaggggccggggttataatcccggacacttcacttctcca |
17683882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #281
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 20753213 - 20753108
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||| | || |||| |||||||| ||| |||| ||||||||||||||||||| ||||| | ||| ||||| | ||||| |||||||| |
|
|
| T |
20753213 |
tagctcagttggtaggaaaat-gcattattatatgtaggggccggggttcgaaccccggacaccacacttattcac-cttataag-gtgaattctagcca |
20753117 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
20753116 |
ctaggctac |
20753108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #282
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 29922387 - 29922472
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| ||||||||||| | | ||| |||| | ||| |||||||||||| ||||| |
|
|
| T |
29922387 |
tgtgagtttaactcagttggtaaggatattgcatat--tatgcaggagctgtgattcaaacctcagacgtcccacttctccatattta |
29922472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #283
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 168
Target Start/End: Original strand, 32006500 - 32006540
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
32006500 |
gtgagtttagctcagttggtagggataatgcataatatatg |
32006540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #284
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 190
Target Start/End: Original strand, 35031390 - 35031445
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35031390 |
tagctcagttggtagg-acaatgcattattatatgcaggagccgaggttcgaacccc |
35031445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #285
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 39401003 - 39401119
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtgtgaac |
225 |
Q |
| |
|
||||||||| ||||||||||| ||| | |||||| |||||||||| | ||| |||| ||||| | ||||| |||||||||||||| |||||||||| | |
|
|
| T |
39401003 |
gtgagtttaactcagttggtaaggacaaatgcataatatatgcaggggtcgaagttcaaaccctgaacaccacacttctccacattaaatatgtgtgagc |
39401102 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|| | ||||||||||| |
|
|
| T |
39401103 |
tccggtcactaggctac |
39401119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #286
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 200
Target Start/End: Original strand, 46799440 - 46799479
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46799440 |
tattatatgcag-agccgaggttcgaaccccggacacccca |
46799479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #287
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 48949683 - 48949747
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| ||||| ||||||| ||||||||| |||||||| |
|
|
| T |
48949683 |
ggttcgaatcccggacactccacttctccacaatttaattgtgtgagctctagccaataggctac |
48949747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #288
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 233
Target Start/End: Original strand, 2565091 - 2565186
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||| | | | |||||| ||||||||| ||||||||||| ||| |||||||| |||||||| |
|
|
| T |
2565091 |
ctcaattgatagggatattacatattatatgcaggggttgggattcgaatcccggacactccacttctccatattataatgtgtgagttctagcca |
2565186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #289
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 3465615 - 3465658
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3465615 |
tattatatgcaggggccggagttcgaaccccggacaccccactt |
3465658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #290
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 3904347 - 3904461
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||| ||| || || ||||||||||| |||| |||| ||||||| ||||| ||||| || ||| ||| | ||||||| || |
|
|
| T |
3904347 |
gtgagcttagctcagttggtagagatgctgtattttatatgcaggggccg-ggtttgaaccccagacactccactcatctacaattaaattgtgtgagct |
3904445 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
3904446 |
ctagccactatgctac |
3904461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #291
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 187
Target Start/End: Original strand, 7272520 - 7272579
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaac |
187 |
Q |
| |
|
|||| ||||||||||||| || ||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
7272520 |
gtgaatttagctcagttgataaggatattgcatattatatgtaggggccggagttcgaac |
7272579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #292
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 7768851 - 7768808
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
7768851 |
tattatatgcagaggccggggttcgaaccccggacaccccactt |
7768808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #293
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 191
Target Start/End: Complemental strand, 8027458 - 8027395
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
191 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| |||||||| || | | ||||| ||||||| |
|
|
| T |
8027458 |
gtgagtttagctcagttggtaaggataatgcataatatatgcaagatcgggggttcaaaccccg |
8027395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #294
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 10098157 - 10098200
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
10098157 |
tattatatgcaggggccgggattcgaaccccggacaccccactt |
10098200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #295
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 12763617 - 12763723
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccac |
234 |
Q |
| |
|
||||| |||||||||| || ||| ||||||||| |||| || | |||||||| | || || |||||||||||||||||| ||||||| |||||| ||| |
|
|
| T |
12763617 |
tagcttagttggtagg-attttgaatattatatacaggggctggggttcgaatctcgagcatcccacttctccacatttaattgtgtgagctctagtcac |
12763715 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
||| |||| |
|
|
| T |
12763716 |
tagactac |
12763723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #296
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 210
Target Start/End: Complemental strand, 21162312 - 21162229
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||| || |||||||||| ||||| ||||||||||||||| | || |||| ||||||| || ||| || ||||||||| |
|
|
| T |
21162312 |
tgtgagcttaacttagttggtaggaatattacatattatatgcaggggtcggggtttgaacccctgatacctcatttctccaca |
21162229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #297
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 203
Target Start/End: Complemental strand, 22096466 - 22096411
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| |||| | ||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
22096466 |
agggataatgcacaatatgtgcaggggccgaggttcgaactccggacaccccactt |
22096411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #298
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 24234137 - 24234094
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
24234137 |
tattatatgcaggggccggggtttgaaccccggacaccccactt |
24234094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #299
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 165
Target Start/End: Complemental strand, 24997511 - 24997464
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattat |
165 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
24997511 |
atttattcccgtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #300
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 26885495 - 26885420
Alignment:
| Q |
129 |
tgagtttagctcagttggtaggg-atattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||| |||| ||| |||| ||||||||| || |||| |||||||||||||||||| |||||| |
|
|
| T |
26885495 |
tgagcttagctcatttggcaggggataatgcacattatatgctggggccggggttcgaaccccggacactccactt |
26885420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #301
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 32898439 - 32898550
Alignment:
| Q |
128 |
gtgagtttagctcagttggtaggga-tattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaac |
225 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||| ||||||| ||| |||| ||||||||| ||||||| ||||||||| |||| | |||||||| | |
|
|
| T |
32898439 |
gtgagcttagctcagttggtagggacaaatgcattttatatgtaggggccggggttcgaacattggacaccatacttctccatatttaaaatgtgtgagc |
32898538 |
T |
 |
| Q |
226 |
tctagccactag |
237 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
32898539 |
tccagccactag |
32898550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #302
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 36257726 - 36257769
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
36257726 |
tattgtatgcaggggccggggttcgaaccccggacaccccactt |
36257769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #303
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 203
Target Start/End: Complemental strand, 40407067 - 40406980
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgagg-ttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| |||| |||||||| |||||| |||||| |||| | ||| |||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
40407067 |
atttatccccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccgggggttcgaaccccggacaccccactt |
40406980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #304
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 235
Target Start/End: Complemental strand, 42916872 - 42916790
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgtgtgaactctagccact |
235 |
Q |
| |
|
||||||| ||||||||||||| || |||||||||||||| ||| ||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
42916872 |
gatattgtatattatatgcagt---cggggttcgaaccccggccactccacttctccacagtttaattgtgtgagctctagccact |
42916790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #305
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 45617302 - 45617353
Alignment:
| Q |
163 |
tatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
45617302 |
tatatgcaggggccggggttctaaccccggacacctcactcctccacattta |
45617353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #306
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 50376716 - 50376602
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
||||||||| |||||||||||| || |||||||| |||||||||| | | |||||||||||| |||| ||||| ||||||||| | |||||||| || |
|
|
| T |
50376716 |
gtgagtttaactcagttggtagagacattgcataatatatgcaggggaaggggttcgaaccccaaacacttcactt-tccacatttaaaatgtgtgagct |
50376618 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
| |||| |||| |||| |
|
|
| T |
50376617 |
ccagccgctagtctac |
50376602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #307
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 236
Target Start/End: Complemental strand, 194713 - 194635
Alignment:
| Q |
159 |
atattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||||| |||||| ||||| ||||| ||||||| ||||||||||| |
|
|
| T |
194713 |
atattatatgcaggggttggggttcgaaccccggacactccacttgtccacaatttaattgtgtgagttctagccacta |
194635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #308
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 167
Target Start/End: Complemental strand, 2034163 - 2034117
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
2034163 |
tatccccgtgagtttagctcagttggtatggataatgcataatatat |
2034117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #309
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 197
Target Start/End: Original strand, 3936622 - 3936696
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||||||||| ||||||||||||||| | | | |||||| |||||||| | ||| |||||||||||||| |||| |
|
|
| T |
3936622 |
tccctgtgagcttagctcagttggtatgaacaatgcataatatatgcaaggtccggggttcgaaccccggccacc |
3936696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #310
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 210
Target Start/End: Original strand, 5801982 - 5802040
Alignment:
| Q |
152 |
atattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||| | |||| ||||||||||||| |
|
|
| T |
5801982 |
atattgcatattatatgcaggggctggggttcgaacctcacacactccacttctccaca |
5802040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #311
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 167
Target Start/End: Complemental strand, 16193245 - 16193199
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
16193245 |
tatccccgtgagtttaactcagttggtaaggatattgtatattatat |
16193199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #312
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 167
Target Start/End: Complemental strand, 17221886 - 17221848
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
17221886 |
tgagtttagctcagttggtagagatattgtatattatat |
17221848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #313
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 168
Target Start/End: Complemental strand, 18424954 - 18424924
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18424954 |
ctcagttggtagggatattgcatattatatg |
18424924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #314
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 191
Target Start/End: Original strand, 19908689 - 19908755
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
191 |
Q |
| |
|
|||||||| ||| ||||||||||| ||| | |||||| |||||||| | ||||||||||||||||| |
|
|
| T |
19908689 |
cctgtgagcttaactcagttggtaaggacaatgcataatatatgcaaggtccgaggttcgaaccccg |
19908755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #315
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Complemental strand, 20096331 - 20096289
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
20096331 |
gtgagtttaactcagttggtagggataatgcataatatatgca |
20096289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #316
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 233
Target Start/End: Complemental strand, 23132866 - 23132769
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||| ||| ||||| |||||||| | |||||||| || ||||||||| |||||||||| ||||||||| ||||| |||||||| ||| ||||| |
|
|
| T |
23132866 |
tagctcaattgacagggacattgcataatttatgcagggatcggggttcgaactccggacaccc-acttctccatatttaaatgtgtgagctccagcca |
23132769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #317
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 242
Target Start/End: Original strand, 29356328 - 29356394
Alignment:
| Q |
177 |
gaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||| ||||||| |||||||| |||||||| |
|
|
| T |
29356328 |
gaggttcgaaccccggacactccatttctccacaatttaattgtgtgagttctagccattaggctac |
29356394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #318
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 203
Target Start/End: Original strand, 37110869 - 37110934
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | ||||| ||||||| || |||||||| |||| |
|
|
| T |
37110869 |
gctcagttggtagggatattgcatgatatatgcaagggccga-gttcgaaacctggacaccctactt |
37110934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #319
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 196
Target Start/End: Complemental strand, 47554423 - 47554353
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||||| ||| ||||||| |||| |||||| || ||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
47554423 |
ctgtgagcttaactcagttagtagagatattatattttatatgcaggagtcgaagttcgaaccctggacac |
47554353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #320
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 223
Target Start/End: Original strand, 52556943 - 52557037
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||| |||||||| |||||||||| ||| |||| | ||| ||| | || |||||||||||| ||||||||||||| ||| |||| |||||||| |
|
|
| T |
52556943 |
tgagcttagctcatttggtagggacattacataatttatacagaggtcggggttcgaacccctaacaccccacttctacacgtttaaatgtgtga |
52557037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #321
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 238
Target Start/End: Complemental strand, 3297263 - 3297186
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactagg |
238 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||| || |||||||||||| ||| | ||||||||||||| | |||||| |
|
|
| T |
3297263 |
ttatatgcaggggccggggttcgaacttcggacgcctcacttctccacaattaaattgtgtgaactctatcaactagg |
3297186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #322
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 223
Target Start/End: Complemental strand, 6171026 - 6170941
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||| |||||||||| |||||||| | |||| ||| || | |||||||||| | ||||| | ||||||||||||||| ||||||| |
|
|
| T |
6171026 |
ctcaattggtagggacattgcataatttatgtaggggctggggttcgaacctcagacactctacttctccacatttaattgtgtga |
6170941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #323
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 214
Target Start/End: Original strand, 7043892 - 7043973
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||||||| || ||||||||||||||| || ||||| | ||||||||| || ||| || |||||||||||||||| |
|
|
| T |
7043892 |
tttagatcagttgataaggatattgcatattaaatataggagttggggttcgaactccagactcctcacttctccacattta |
7043973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #324
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 235
Target Start/End: Original strand, 8564169 - 8564282
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgtgt |
221 |
Q |
| |
|
|||| |||||||||||||| |||| | ||| |||||||| | ||| |||| | | ||||||||| |||||| |||| ||||||||| |||| ||||| |
|
|
| T |
8564169 |
tccccgtgagtttagctcaattggcatggacattgcataatttatacaggggtcagagttcgaacctcggacatcccatttctccacattttaattgtgt |
8564268 |
T |
 |
| Q |
222 |
gaactctagccact |
235 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
8564269 |
gagctctagccact |
8564282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #325
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 208
Target Start/End: Original strand, 11826481 - 11826537
Alignment:
| Q |
151 |
gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||||| |||||||||||||| | | ||||||||||||||||||| |||||||||| |
|
|
| T |
11826481 |
gatattgtatattatatgcaggggttg-ggttcgaaccccggacaccacacttctcca |
11826537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #326
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 12856191 - 12856259
Alignment:
| Q |
135 |
tagctcagttggtagggatattgca-tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| ||| |||| ||||||||| ||| | || |||||||||||||||||||||||| |
|
|
| T |
12856191 |
tagctcagttggtagg-ataatgcactattatatgaaggggtcggagttcgaaccccggacaccccactt |
12856259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #327
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 20166350 - 20166391
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
20166350 |
ttatatgcaggggccgaggttcgaaccccagataccccactt |
20166391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #328
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 21476169 - 21476101
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| |||| ||||||||| |||||||||||| | ||| |||||||| ||||||| ||||||| |
|
|
| T |
21476169 |
tagctcagttgatagg-atattgcattattatatgcaggggtcgatgttcgaactccggacatcccactt |
21476101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #329
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 167
Target Start/End: Complemental strand, 22654107 - 22654062
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||||||||| |||||||| |||||||| ||||||||| |||||| |
|
|
| T |
22654107 |
atccctgtgagcttagctcaattggtaggaatattgcattttatat |
22654062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #330
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 195
Target Start/End: Original strand, 27921903 - 27921963
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
|||||||||||||||||| || |||| |||||||||||| |||| |||||||||||| |||| |
|
|
| T |
27921903 |
tagctcagttggtagggacat-gcattattatatgcaggggccggggttcgaaccccagaca |
27921963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #331
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 187
Target Start/End: Complemental strand, 29889879 - 29889814
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaac |
187 |
Q |
| |
|
|||||||||| |||||||| | ||| |||||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
29889879 |
tccctgtgagcttagctcactatgtaagggataatgcatattatatgcaggggccggggttcgaac |
29889814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #332
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 31109292 - 31109349
Alignment:
| Q |
157 |
gcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||| | || ||||||||||||| |
|
|
| T |
31109292 |
gcatattaaatgcagaggccggggttcgaaccccggacatctcatttctccacattta |
31109349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #333
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 42758251 - 42758184
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| ||||||| || |||| |||||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
42758251 |
tagctcagtttgtagggacat-gcattattatatgcaggggccg-ggttcgaaccctggacaccccactt |
42758184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #334
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 212
Target Start/End: Original strand, 47230779 - 47230812
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
47230779 |
ggttcgaaccacggacaccccacttctccacatt |
47230812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #335
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 139 - 203
Target Start/End: Original strand, 49743373 - 49743437
Alignment:
| Q |
139 |
tcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||||| |||| | ||||||||||||||||| ||||| |
|
|
| T |
49743373 |
tcagttggcagggatat-gcattattatatgcaggggccgggattcgaaccccggacacctcactt |
49743437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #336
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 53355023 - 53354986
Alignment:
| Q |
166 |
atgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
53355023 |
atgcaggggccggggttcgaaccccggacaccccactt |
53354986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #337
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 172
Target Start/End: Original strand, 7657058 - 7657110
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||| ||||| ||| ||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
7657058 |
ttatccccgtgagcttatctcagttggtaaggatgttgtatattatatgcagg |
7657110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #338
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 203
Target Start/End: Original strand, 12850720 - 12850784
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| | ||| || ||||| |||||||||| | |||| ||||||||| ||||||||||||| |
|
|
| T |
12850720 |
tcagttggcatggacatagcatagtatatgcaggggtcgagattcgaaccctggacaccccactt |
12850784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #339
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 242
Target Start/End: Original strand, 13088938 - 13089026
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| | |||||||| | || |||||||| | |||||||||||||| |||||||| | ||||||| | |||| || |||||||| |
|
|
| T |
13088938 |
attgcataatttatgcaggggtcggggttcgaatctcggacaccccacttttccacattaaattgtgtgagcactaggcattaggctac |
13089026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #340
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 21765469 - 21765429
Alignment:
| Q |
163 |
tatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
21765469 |
tatatgcaggggccaaggttcgaacctcggacaccccactt |
21765429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #341
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 242
Target Start/End: Complemental strand, 23556050 - 23555962
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| | |||||||| | ||| |||||||| || | |||||||||||||||||||| | ||||| |||||| |||||||||| |
|
|
| T |
23556050 |
attgcataatttatgcagggactgagattcgaacctcgaataccccacttctccacatttaattatgtgagctctagttactaggctac |
23555962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #342
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 28465835 - 28465727
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||| ||||| |||||| |||||||| | || ||| | || ||||||||| || |||||| |||||||||||| ||| ||||||| ||||||||| |
|
|
| T |
28465835 |
ttagcttagttgatagggacattgcataattaatctaggggtcggggttcgaactccagacacctcacttctccacaattaattgtgtgagctctagcca |
28465736 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|| ||||| |
|
|
| T |
28465735 |
ttacgctac |
28465727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #343
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 35888836 - 35888768
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| ||| |||||| ||||||| | ||||||||||| | ||||||||||||| || |||||||| |
|
|
| T |
35888836 |
tagctcaattgatagggacattgcatgtaatatgcaggagttggggttcgaaccccgaactccccactt |
35888768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #344
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 200
Target Start/End: Original strand, 36954169 - 36954209
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
36954169 |
tattatatgcaggggtcggggttcgaaccccggacacccca |
36954209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #345
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 37889670 - 37889626
Alignment:
| Q |
159 |
atattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||||| ||||| |
|
|
| T |
37889670 |
atattatatgcaggggtcggggttcgaaccccggacacctcactt |
37889626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #346
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 200
Target Start/End: Original strand, 43115300 - 43115340
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
43115300 |
tattatatgcaggggtcgagattcgaaccccggacacccca |
43115340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #347
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 44315569 - 44315525
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||| |||||||| |
|
|
| T |
44315569 |
tgcatattatatgcaggagccgggattcaaaccccgaacacccca |
44315525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #348
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 52031206 - 52031282
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| ||||||||||||| ||| | | ||||| | |||||||||| | || |||||||||||| |||||||||||| |
|
|
| T |
52031206 |
gtgagcttagctcagttggcaggaacaatgcattagtatatgcaggggtcggggttcgaaccccagacaccccactt |
52031282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #349
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 52330969 - 52330929
Alignment:
| Q |
163 |
tatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
52330969 |
tatatgcaggggccggggttcgaactccggacaccccactt |
52330929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #350
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 173
Target Start/End: Complemental strand, 53655815 - 53655771
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcagga |
173 |
Q |
| |
|
||||||||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
53655815 |
tgagtttagctcaattggtagagatatttgatattatatgcagga |
53655771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #351
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 53758974 - 53759049
Alignment:
| Q |
128 |
gtgagtttagctcagttggt-agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||| |||||||||| | || ||||||| ||||||||| |||||| |
|
|
| T |
53758974 |
gtgagtttagctcaattggtaagggataatgcata-tatatgcaggggtcggagttcgaatcccggacactccactt |
53759049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #352
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 229
Target Start/End: Original strand, 55219446 - 55219538
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactcta |
229 |
Q |
| |
|
|||| |||| |||||||||| || |||||||| || | || |||||||| || ||||| |||| |||||||||||| |||||||| ||||| |
|
|
| T |
55219446 |
gctcggttgttagggatattacacattatatgtgggggtcggagttcgaactccagacacgccacctctccacatttacatgtgtgagctcta |
55219538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 279)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 29617399 - 29617523
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | | |
|
|
| T |
29617399 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaatt |
29617498 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
29617499 |
gtgtgagctctagccactaggctac |
29617523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 10244964 - 10244841
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||| | || |
|
|
| T |
10244964 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccggacaccccacttctccacaattaaattg |
10244865 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
10244864 |
tgtgagctctagccactaggctac |
10244841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 48119466 - 48119588
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||| ||| |
|
|
| T |
48119466 |
tatccctgtgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccacaatttaattgt |
48119565 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
48119566 |
gtgagctctagccactaggctac |
48119588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 32677016 - 32676894
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
32677016 |
tatccctttgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
32676917 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||| ||||| |
|
|
| T |
32676916 |
gtgagctctagccactaagctac |
32676894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 35950124 - 35950246
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
35950124 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgt |
35950223 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
35950224 |
gtgagctctagccactaggctac |
35950246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 12640662 - 12640541
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||| ||| | |||| |
|
|
| T |
12640662 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccacaattaaattgtg |
12640563 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
12640562 |
tgagctctagccactaggctac |
12640541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 23102631 - 23102510
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtg |
23102532 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
23102531 |
tgagttctagccactaggctac |
23102510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 31026216 - 31026337
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
31026315 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
31026316 |
tgagctctagccactaggctac |
31026337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 121 - 240
Target Start/End: Complemental strand, 9877341 - 9877221
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | ||| |
|
|
| T |
9877341 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgt |
9877242 |
T |
 |
| Q |
220 |
gtgaactctagccactaggct |
240 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
9877241 |
gtgagttctagccactaggct |
9877221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 21066883 - 21067003
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
21066883 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacatctcacttctccacatttaattgtgc |
21066982 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
21066983 |
gagctctagccactaggctac |
21067003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 24781033 - 24781148
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
24781033 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccacaattaaattgtgtgagct |
24781132 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24781133 |
ctagccactaggctac |
24781148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 15238885 - 15239007
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||| ||||| ||| |
|
|
| T |
15238885 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccataatttaattgt |
15238984 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
15238985 |
gtgagctctagccactaggctac |
15239007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 26801803 - 26801681
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||| ||| | ||| |
|
|
| T |
26801803 |
tatccccgtgagtatagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttcttcacaattaaattgt |
26801704 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
26801703 |
gtgagctctagccactaggctac |
26801681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 3766808 - 3766929
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
3766907 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
3766908 |
tgagctctaaccactaggctac |
3766929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 42443686 - 42443807
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||| ||| | |||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaagttgtg |
42443785 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
42443786 |
tgagctctagccactaggctac |
42443807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 24061405 - 24061281
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||| ||| | | |
|
|
| T |
24061405 |
tttatccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaatt |
24061306 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||||||||||| |||| |
|
|
| T |
24061305 |
gtgtgagctctagccactagactac |
24061281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 27424836 - 27424956
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||||||||||||||||||||||| |||| |||||||||| |||| || ||||||||||||||||| ||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaacctcggatactccacttctccacatttaattgtgt |
27424935 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
27424936 |
gagctctagccactaggctac |
27424956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 36174393 - 36174508
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| ||| | ||||||| || |
|
|
| T |
36174393 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttttccacaattaaattgtgtgagct |
36174492 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
36174493 |
ctagccactagactac |
36174508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 36391971 - 36391856
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
36391971 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
36391872 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
36391871 |
ctagccactgggctac |
36391856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 19753042 - 19752920
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||| |||||||||||| ||||| ||| |
|
|
| T |
19753042 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccctggacactccacttctccacaatttaattgt |
19752943 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
19752942 |
gtgagttctagccactaggctac |
19752920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 48719808 - 48719917
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
48719808 |
ttagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccacaatttaattgtgtgagctctagcc |
48719907 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
48719908 |
actaggctac |
48719917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 35645609 - 35645717
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||| ||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
35645609 |
tagctcagttggtagggatattgtatattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagcca |
35645708 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
35645709 |
ctaggctac |
35645717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 36469781 - 36469657
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatat |
217 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||| ||||||||||| ||||| | |
|
|
| T |
36469781 |
tttatccccgtgagcttagctcagttggtagggatattacatattacatgcaggagccggggttcgaaccccggacactccacttctccataatttaatt |
36469682 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| | |||||||||||||||| |
|
|
| T |
36469681 |
gtgtgagcgctagccactaggctac |
36469657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 12772118 - 12772233
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| || ||||||||||| | ||| | ||||||| || |
|
|
| T |
12772118 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggatactccacttctccataattaaattgtgtgagct |
12772217 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12772218 |
ctagccactaggctac |
12772233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 27510324 - 27510209
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| ||| ||||||||| ||| | ||||||| || |
|
|
| T |
27510324 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgatccccgtacactccatttctccacaattaaattgtgtgagct |
27510225 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27510224 |
ctagccactaggctac |
27510209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 238
Target Start/End: Complemental strand, 30388574 - 30388463
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
30388574 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
30388475 |
T |
 |
| Q |
227 |
ctagccactagg |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30388474 |
ctagccactagg |
30388463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 137 - 242
Target Start/End: Complemental strand, 1563797 - 1563691
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||| ||| | ||||||| ||||| ||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctctacaattaaattgtgtgagctctaaccact |
1563698 |
T |
 |
| Q |
236 |
aggctac |
242 |
Q |
| |
|
||||||| |
|
|
| T |
1563697 |
aggctac |
1563691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 4960788 - 4960902
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||| || |||||||||||| ||||| ||||||||||||| ||| | ||||||| ||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatgcaggagtcggggttcgaacccctgacactccacttctccacaattaaattgtgtgagctc |
4960887 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4960888 |
tagccactaggctac |
4960902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 44616598 - 44616720
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
44616598 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcaaaacccggacactccacttctccacaattaaattgt |
44616697 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| ||||||| |||| |
|
|
| T |
44616698 |
gtgagctctaaccactagactac |
44616720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 138 - 223
Target Start/End: Complemental strand, 1398960 - 1398875
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1398960 |
ctcagttggttgggatattgcatattatatgcaggggccggggttcgaatcccggacaccccacttctccacatttatatgtgtga |
1398875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 12364745 - 12364866
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| ||| |||| ||||||||||||||| ||||||||| ||| || ||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
12364745 |
tatccccgtgagcttaactcacttggtagggatattgtatattatatacagaggctaaggttcgaatcccagacaccccacttctccacatttatatgtg |
12364844 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
12364845 |
tgagctctagccactaggctac |
12364866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 24880513 - 24880404
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
24880513 |
ttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccgaacactccacttctccacaattaaattgtgtgagctctagcc |
24880414 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
| |||||||| |
|
|
| T |
24880413 |
aataggctac |
24880404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 32619347 - 32619468
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||| || ||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
32619347 |
atccccgtgagcttaactcagttgttaaggatattgcatattatatgtaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
32619446 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
32619447 |
tgagctctagccactaggctac |
32619468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 24508821 - 24508944
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
24508821 |
ttatcccagtgagcgtagttcagttggtagggatattgcatattatatgatggagccggggttcgaaccccggacattccacttctccacaattaaattg |
24508920 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
24508921 |
tgtgagctctagccactaggctac |
24508944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 33996954 - 33996839
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| ||||||||||| | ||| | |||| |
|
|
| T |
33996954 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccctggacactccacttctccataattaaattgtg |
33996855 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
33996854 |
tgagctctagccacta |
33996839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 34267618 - 34267503
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||| |||||||||||| ||| | ||||||| || |
|
|
| T |
34267618 |
gtgagcttagctcagttggtaggaatattgcatattatatgcaggagctggggttcgaaccccggacacttcacttctccacaattaaattgtgtgagct |
34267519 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
34267518 |
ctagtcactaggctac |
34267503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 120 - 210
Target Start/End: Original strand, 2681091 - 2681181
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| || |||||||||| |
|
|
| T |
2681091 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccccttctccaca |
2681181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 9497962 - 9498084
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| | |||||||||||| |||||||||||||||||||||||||| ||| | || |||||||||||||||||||||||||||||||| ||| | | | |
|
|
| T |
9497962 |
tatccccgcgagtttagctcaattggtagggatattgcatattatatgtaggggtcggggttcgaaccccggacaccccacttctccacaattaaattat |
9498061 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||| |||| |
|
|
| T |
9498062 |
gtgaactatagccactagactac |
9498084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 25833547 - 25833673
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttat |
215 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||||| || || |||||||||||| ||||| |
|
|
| T |
25833547 |
aattgatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaa |
25833646 |
T |
 |
| Q |
216 |
atgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| | |||||||||||||||||| |
|
|
| T |
25833647 |
ttgtgtaagctctagccactaggctac |
25833673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 13720779 - 13720888
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc-acatttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||| |||| |||||||||| | ||||| ||||||| |||||||| |
|
|
| T |
13720779 |
ttagctcagttggttgggatattgcatattatatgcaggggccggggttcgaaccccgaacactccacttctccaaaatttaattgtgtgagctctagcc |
13720878 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
13720879 |
actaggctac |
13720888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 234
Target Start/End: Original strand, 30806112 - 30806225
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||| |||||||||||||| ||| | |||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaaccccggacatcccacttctccacaattaaattgtg |
30806211 |
T |
 |
| Q |
221 |
tgaactctagccac |
234 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
30806212 |
tgagttctagccac |
30806225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 38889566 - 38889445
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||||||| || |||||||| ||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
38889566 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggggctgaggttcgtaccccagacactccacttctccacaatttaattgtg |
38889467 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
38889466 |
tgagctctatccactaggctac |
38889445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 47999777 - 47999898
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| |||||| | |||||||| ||||||||| ||||||||||| | ||| | |||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggagctggggttcgaatcccggacactccacttctccataattaaattgtg |
47999876 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| |||||||| |
|
|
| T |
47999877 |
tgagctctagccattaggctac |
47999898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 32074471 - 32074347
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| ||| ||||||||||| || | |||||||||||||||||| ||||||||||||| ||| | | |
|
|
| T |
32074471 |
tttatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggggctggggttcgaaccccggacactccacttctccacaattaaatt |
32074372 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||||| |||||||||| |
|
|
| T |
32074371 |
gtgtgagctctagctactaggctac |
32074347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 138 - 240
Target Start/End: Original strand, 8174129 - 8174232
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||| | ||||||||||| ||| | ||||||| |||||||||||| |
|
|
| T |
8174129 |
ctcagttggtagggatattgcattttatatgcaggagctggggttcgaaccccggacactctacttctccacaattaaattgtgtgagctctagccacta |
8174228 |
T |
 |
| Q |
237 |
ggct |
240 |
Q |
| |
|
|||| |
|
|
| T |
8174229 |
ggct |
8174232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 15106766 - 15106643
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| ||||||||||||| ||| | || |
|
|
| T |
15106766 |
ttatcccggtgagcttaactcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttctccacaattaaattg |
15106667 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| || |||||| ||| |||| |
|
|
| T |
15106666 |
tgtgagctttagccagtagactac |
15106643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 30940766 - 30940889
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||| ||||||||||||||||||||| |||| |||||||| |||| |||| |||||||||||| ||||| || |
|
|
| T |
30940766 |
ttatccccgtgagcttagctcagttggtagtgatattgcatattatatgcagaggccggggttcgaatcccgaacacaccacttctccacaatttaattg |
30940865 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
| ||||||||||||||||| |||| |
|
|
| T |
30940866 |
tttgaactctagccactagactac |
30940889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 240
Target Start/End: Complemental strand, 43633151 - 43633044
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |||||||| ||||||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
43633151 |
ttagctcagttgatagggatattatatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagcc |
43633052 |
T |
 |
| Q |
233 |
actaggct |
240 |
Q |
| |
|
|||||||| |
|
|
| T |
43633051 |
actaggct |
43633044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 47641040 - 47641163
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||| ||| || | |||||||||||| ||||| |||||||||||| ||||| || |
|
|
| T |
47641040 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggctggggttcgaaccccagacactccacttctccacaatttaattg |
47641139 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||| | |||| ||||||||||||| |
|
|
| T |
47641140 |
tgtaagctctggccactaggctac |
47641163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 9712265 - 9712183
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
9712265 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccaca |
9712183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 241
Target Start/End: Complemental strand, 13730165 - 13730051
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||| |||||| ||||||||| |||||||||||||||||||||| |||| |||| ||||||||||||| ||| ||||||| ||||| ||||||| || |
|
|
| T |
13730165 |
tgtgagcttagcttagttggtagagatattgcatattatatgcaggggccggggtttgaaccccggacactccatttctccatatttaattgtgtgagct |
13730066 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
13730065 |
ctagtcactaggcta |
13730051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 125 - 242
Target Start/End: Complemental strand, 32984287 - 32984169
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtga |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||| || ||||| |||||||||||| | ||||||||||| ||| | ||||||| |
|
|
| T |
32984287 |
cctgtgagcttagctcagttggtagggatattgcatattatatacaggagtcggggttcaaaccccggacactctacttctccacaattaaattgtgtga |
32984188 |
T |
 |
| Q |
224 |
actctagccactaggctac |
242 |
Q |
| |
|
||||| ||| |||||||| |
|
|
| T |
32984187 |
gctctaaccattaggctac |
32984169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 46534814 - 46534700
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||| ||| | ||||||| ||| |
|
|
| T |
46534814 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagcctgagttcgaaccccgaacactccacttctccacaattaaattgtgtgagctc |
46534715 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||| ||| |||| |
|
|
| T |
46534714 |
tagccattagactac |
46534700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 2228972 - 2229093
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||| ||||||||||||||||| ||| | |||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggtttaaaccccgagcaccccacttctccacaattaaattgtg |
2229071 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| ||| |||| |
|
|
| T |
2229072 |
tgagctctagccattagactac |
2229093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 238
Target Start/End: Original strand, 7525441 - 7525558
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||||||||||||||||||||| | ||||||||||| |||||||| | ||||||||||| ||| | |||| |
|
|
| T |
7525441 |
atccccgtgagtttagttcagttggtaaggatattgcatattatatgcaggggtcgaggttcgaattccggacactctacttctccacaattaaattgtg |
7525540 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
7525541 |
tgagctctagccactagg |
7525558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 128 - 241
Target Start/End: Complemental strand, 18223784 - 18223672
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||| | || ||| ||||||||||||||||||||||||||||||| ||| || |||| ||| |
|
|
| T |
18223784 |
gtgagcttaactcagttggtagggatattgcatattatatgtaagatccggagttcgaaccccggacaccccacttctccacaattaaat-tgtgtgctc |
18223686 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18223685 |
tagccactaggcta |
18223672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 18503541 - 18503432
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||| || || || |
|
|
| T |
18503541 |
ttagctcggttggaagagatattgcatattatatgcaggggctgaggttcgaaccccagacaccccacttctccacatttaaaatgtgtgagctttaacc |
18503442 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
18503441 |
actaggctac |
18503432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 24188480 - 24188588
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| | || |||||||||||| ||||||||||||||||||| ||| | ||||||| | |||||| |
|
|
| T |
24188480 |
tagctcagttggtagggatactgcatattatatgcaggggtcggggttcgaaccccagacaccccacttctccacaattaaattgtgtgagccatagcca |
24188579 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
24188580 |
ctaggctac |
24188588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 31769568 - 31769464
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| | ||||||||||| ||| | ||||||| || |||||||||| |
|
|
| T |
31769568 |
tcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactctacttctccacaattaaattgtgtgagctttagccactag |
31769469 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
31769468 |
gctac |
31769464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 146 - 241
Target Start/End: Original strand, 32047110 - 32047206
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| ||||||||||||||||||| |||||||||||| ||| | ||||||| ||||||||||||||||| |
|
|
| T |
32047110 |
gtagggatattgcatgttatatgcaggggccggggttcgaaccccggacacctcacttctccacaattaaattgtgtgagctctagccactaggcta |
32047206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 118 - 241
Target Start/End: Original strand, 35815831 - 35815955
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata- |
216 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||| |||| ||||||||||| | || |||||||| ||| ||||| ||||||||||||| ||| | |
|
|
| T |
35815831 |
atttatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaatcccagacactccacttctccacaattaaat |
35815930 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||||| ||||||||| ||||||| |
|
|
| T |
35815931 |
tgtgtgagctctagccattaggcta |
35815955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 41465843 - 41465923
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | | ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41465843 |
ttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaactccggacaccccacttctccacattta |
41465923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 5804850 - 5804973
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
|||||||||| || |||||| |||||||||||||||||||| ||||||||| | |||||||||||||||||| | | |||||||||||| ||||| || |
|
|
| T |
5804850 |
ttatccctgtaagcttagcttagttggtagggatattgcattttatatgcaagggccgaggttcgaaccccgtatattccacttctccacaatttaattg |
5804949 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||| ||||| |
|
|
| T |
5804950 |
tgtgagctctagccactaagctac |
5804973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 27788279 - 27788386
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccac |
234 |
Q |
| |
|
||||||| |||| |||||||||||||| | |||||||| |||| |||||||||||| ||||||||||||||||||||||| |||| ||| ||| |||||| |
|
|
| T |
27788279 |
tagctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaatgtatgagctccagccac |
27788378 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
||||||| |
|
|
| T |
27788379 |
caggctac |
27788386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 27791435 - 27791542
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccac |
234 |
Q |
| |
|
||||||| |||| |||||||||||||| | |||||||| |||| |||||||||||| ||||||||||||||||||||||| |||| ||| ||| |||||| |
|
|
| T |
27791435 |
tagctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaatgtatgagctccagccac |
27791534 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
||||||| |
|
|
| T |
27791535 |
caggctac |
27791542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 47437932 - 47438051
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| |||||||||||| |||||||||| | |||||||| | |||||||| || | ||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
47437932 |
tccccgtgagtttagcttagttggtaggaacattgcataatttatgcaggggcaggggttcaaaccccggacactccacttctccacatttaactgtgtg |
47438031 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||||||| |||||||| |
|
|
| T |
47438032 |
agctctagccattaggctac |
47438051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 135 - 201
Target Start/End: Original strand, 21388533 - 21388599
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
21388533 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac |
21388599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 28805304 - 28805418
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| | || |||| ||||||||||||||||||||||||||| ||| | || |||| ||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgcaggggtcggggttagaaccccggacaccccacttctccacaattaaattgagtgagctc |
28805403 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| ||||||| |||| |
|
|
| T |
28805404 |
taaccactagactac |
28805418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 127 - 237
Target Start/End: Original strand, 38151346 - 38151456
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| | |||||||| | || |||||||||| | |||||||||||||||||||||| ||||||| || |
|
|
| T |
38151346 |
tgtgagcttagctcagttggtagggatattgcattatttatgcaggggtcggggttcgaaccatgaacaccccacttctccacatttaattgtgtgagct |
38151445 |
T |
 |
| Q |
227 |
ctagccactag |
237 |
Q |
| |
|
||||||||||| |
|
|
| T |
38151446 |
ctagccactag |
38151456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 49089503 - 49089617
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| || | | |||| |||||||||||||||||||||||||||| || ||||||| ||| |
|
|
| T |
49089503 |
gtgagtttagctcagttgttagggatattgcatgttatatgtagaggtcagggttagaaccccggacaccccacttctccacatataattgtgtgagctc |
49089602 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
49089603 |
tagccactagactac |
49089617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 3532587 - 3532696
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||| ||||||||| ||| ||| | ||||||| |||||||| |
|
|
| T |
3532587 |
ttagttcagttggtagggatattgcataatatatgcaggggccgaggttcgaaccccaaacactccacttctctacaattaaattgtgtgagctctagcc |
3532686 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
3532687 |
actagactac |
3532696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 12264063 - 12264172
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||| |||||||||| | |||| ||||||||||||| ||| | ||||||| ||||| || |
|
|
| T |
12264063 |
ttagctcagttggtagggatattgcattttatatgcaggggccggagttcgaaccctgaacactccacttctccacaattaaattgtgtgagctctatcc |
12264162 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
12264163 |
actaggctac |
12264172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 215
Target Start/End: Complemental strand, 28444155 - 28444062
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat |
215 |
Q |
| |
|
||||| ||||| ||| |||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
28444155 |
atccccgtgagcttaactcagttggtagagatatcgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccacaattat |
28444062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 31077976 - 31077855
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||| || ||||| ||||| |||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
31077976 |
atccccgtgagcttaactcagttggtagggatattacactttatacgcaggggccgcggttcgaaccccggacactccacttctccacaattaaattgtg |
31077877 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
31077876 |
tgagctctagccactagactac |
31077855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 201
Target Start/End: Complemental strand, 48288468 - 48288395
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
48288468 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggttcgaatcccggacactccac |
48288395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 121 - 236
Target Start/End: Complemental strand, 5990219 - 5990104
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| |||||||||||||| | || | |||||||||||||||| |||||||||||| ||||| ||| |
|
|
| T |
5990219 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggcg-cgggattcgaaccccggacactccacttctccacaatttaattgt |
5990121 |
T |
 |
| Q |
220 |
gtgaactctagccacta |
236 |
Q |
| |
|
|||| || ||||||||| |
|
|
| T |
5990120 |
gtgagctttagccacta |
5990104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 3062770 - 3062892
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| || ||||||| ||| ||||||| |||||| ||||||| || |||||||| |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
3062770 |
ttatccccgtaagtttagtccagatggtaggaatattgtatattat-tgaaggagccggggttcgaaccccggacactccacttctccacaattaaattg |
3062868 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
3062869 |
tgtgagctctagccactaggctac |
3062892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 7401454 - 7401339
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| | |||| ||||| ||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
7401454 |
gtgagtttaactcagttggtagggatattgtatattatatgcaggaattggggtttgaacctcggacactccacttctccacaattaaattgtgtgagct |
7401355 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
7401354 |
ctagccactagactac |
7401339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 35683194 - 35683079
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||| |||| ||||||||||| | || ||||||||| |||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
35683194 |
gtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaactccggacactccacttctccacaattaaattgtgtgagct |
35683095 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||| |
|
|
| T |
35683094 |
ctatccattaggctac |
35683079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 15021278 - 15021164
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| |||| |||||||||| |||||||| | ||| |||||| || ||||||||||||||||||| || || |||||||||| |||||||| ||| |
|
|
| T |
15021278 |
gtgagcttaactcaattggtagggagattgcataatttatacaggagtcggggttcgaaccccggacacctcatttttccacatttaaatgtgtgagctc |
15021179 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
15021178 |
tagccactagactac |
15021164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 21762966 - 21762844
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||| ||| ||||||||||| ||||||||||||||||||||||| | || | |||||||| | || |||||||||||||||| ||| | ||| |
|
|
| T |
21762966 |
tatccccgtgaacttatctcagttggtaaggatattgcatattatatgcaggggtcgggattcgaacctcagagaccccacttctccacaattaaattgt |
21762867 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
21762866 |
gtgagctctagccactaggctac |
21762844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 229
Target Start/End: Original strand, 36931971 - 36932077
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
||||||||| ||||||||||||| ||||| |||||||| | |||||||| ||| |||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
36931971 |
tccctgtgaacttagctcagttggcagggacattgcataatttatgcagggtccggggttcgaaccccggacaccccacttctctacatttaattgtgtg |
36932070 |
T |
 |
| Q |
223 |
aactcta |
229 |
Q |
| |
|
| ||||| |
|
|
| T |
36932071 |
agctcta |
36932077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 16200556 - 16200677
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||| | |||||||| ||||||||||||||||||||| | || |||||||||||| ||||||||| ||||||||| ||| | |||| |
|
|
| T |
16200556 |
atcccggtgagcttagcttaattggtaggaatattgcatattatatgcaggggtcggggttcgaaccccagacaccccatttctccacaattaaattgtg |
16200655 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||| ||||| |||| |
|
|
| T |
16200656 |
tgatctctagctactagactac |
16200677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 24692471 - 24692592
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||| |||||||||| || ||| ||||||||||||| |||||||| ||| ||| | ||| |
|
|
| T |
24692471 |
tatccccgtgaggttagctcagttggtagggatattgcatattctatgcaggagtcggagtttgaaccccggacactccacttctttacaattaaattgt |
24692570 |
T |
 |
| Q |
220 |
gtgaactctagccactaggcta |
241 |
Q |
| |
|
|||| ||||||| |||| |||| |
|
|
| T |
24692571 |
gtgagctctagcgactacgcta |
24692592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 28424392 - 28424283
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| | |||||||||||||||||| ||||||||||| |||| ||| | ||||||| ||||| || |
|
|
| T |
28424392 |
ttagctcagtttgtagggaaattgcatattatatgcagaggacgaggttcgaaccccggaaaccccacttcttcacaattaaattgtgtgagctctaacc |
28424293 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
28424292 |
actagactac |
28424283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 32856978 - 32856869
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||| || || ||||||||||| ||||| |||||||||||| ||||| | ||||| |||||||| |
|
|
| T |
32856978 |
ttagcttaattggtagggatattgcatattatatgcaggggctgaagttcgaaccccagacactccacttctccacaatttaattatgtgagctctagcc |
32856879 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
32856878 |
actagcctac |
32856869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 35835772 - 35835651
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| | || ||||||||| | |||| |||||||||| | ||||| ||||||||||||| ||| | |||| |
|
|
| T |
35835772 |
atccctgtgagcttagctcagttagtagggatatcgtattttatatgcaagggccggggttcgaacctcagacactccacttctccacaattaaattgtg |
35835673 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
35835672 |
tgagctccagccactaggctac |
35835651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 128 - 241
Target Start/End: Complemental strand, 41331146 - 41331033
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||| ||||| |||||||| | |||||||| | || |||||||| |||||||||||||||||||||||||| ||||||| || |
|
|
| T |
41331146 |
gtgagcttagctcagttggcagggacattgcataatttatgcaggggtcggggttcgaattccggacaccccacttctccacatttaattgtgtgagctt |
41331047 |
T |
 |
| Q |
228 |
tagccactaggcta |
241 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
41331046 |
taaccactaggcta |
41331033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 128 - 237
Target Start/End: Complemental strand, 45284886 - 45284777
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||||||| |||||| |||| ||| | |||||||| | || |||||||||||||||||||||||||||| ||||||| ||||||| ||| |
|
|
| T |
45284886 |
gtgagcttagctcagttgatagggacattgaataatttatgcaggggtcggggttcgaaccccggacaccccacttctcaacatttaattgtgtgagctc |
45284787 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|| ||||||| |
|
|
| T |
45284786 |
taaccactag |
45284777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 125 - 210
Target Start/End: Complemental strand, 48413996 - 48413911
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||| |||||||| |||| || ||||||||||||||||||||||||| ||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
48413996 |
cctgtgagcttagctcaattggcagagatattgcatattatatgcaggagctgagattcgaactccggacactccacttctccaca |
48413911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 15074962 - 15074855
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||| |||||||| |||||||| |||||||||||||| ||| | | ||||| ||||||||| |
|
|
| T |
15074962 |
tagctcagttgatagggatattgcatattatatgcagggaccggggttcgaatcccggaca-cccacttctccacaattaaattatgtgagctctagcca |
15074864 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
15074863 |
ctagactac |
15074855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 45669841 - 45669725
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatatt-gcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||||||||||| ||| ||| |||||| |||||||||||||| |||||||||||||||||||||||| ||| ||||||||| ||| | ||||||| | |
|
|
| T |
45669841 |
gtgagtttagctcaattgatagagatatttgcatattatatgcaacagccgaggttcgaaccccggacactccatttctccacaattaaattgtgtgagc |
45669742 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||| | |||||||||| |
|
|
| T |
45669741 |
tctatctactaggctac |
45669725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 13702036 - 13702143
Alignment:
| Q |
137 |
gctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||| |||| ||||| |||||||||||||||||| |||||||||| | |||||||| ||| |||||| |
|
|
| T |
13702036 |
gctcagttggtagggacaaatgcattttatatgcaggggccggggttcaaaccccggacaccccactcctccacatttaaaatgtgtgagctccagccac |
13702135 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
13702136 |
taggctac |
13702143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 23274886 - 23274767
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| |||||| |||||||||||| |||||||| | |||||||| |||| ||||||||||||||||||||| || |||||| ||| |||||| |
|
|
| T |
23274886 |
tccccgtgagcttagctaagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccatttttccacaattaattgtgtg |
23274787 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||||||| || ||||| |
|
|
| T |
23274786 |
agctctagccattaagctac |
23274767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 46645720 - 46645827
Alignment:
| Q |
137 |
gctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||| |||| |||||||||||||||||||||||| |||||||||| | |||||||| ||| || ||| |
|
|
| T |
46645720 |
gctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccactcctccacatttaaaatgtgtgagctccagtcac |
46645819 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
46645820 |
taggctac |
46645827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 47440877 - 47440762
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtgtgaact |
226 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||| |||||||||| | || ||||||||||| |||||||||||||||||||||| |||||||||| || |
|
|
| T |
47440877 |
tgagcttagctcagttggtagggacaaatgcataatatatgcaggggtcggggttcgaaccctggacaccccacttctccacattaaatatgtgtgagct |
47440778 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
| ||||||||| |||| |
|
|
| T |
47440777 |
ccagccactagactac |
47440762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 47463934 - 47464049
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||| ||||||||| ||||||||||| | | |||||||||| ||||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
47463934 |
gtgagcttaactcagttggtagaaatattgcatgttatatgcaggggttggggttcgaacctcggacaccccacttctccacaattaaattgtgtgatct |
47464033 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
47464034 |
ctatccactaggctac |
47464049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 3529776 - 3529898
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||| |||||| |||| | ||||||||||| || |||| ||| ||||||||| ||| | ||| |
|
|
| T |
3529776 |
tatccccgtgagtttaactcagttggtagggatattgcattttatatacagggactgaggttcgaacttcgaacactccatttctccacaattaaattgt |
3529875 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||| |||| |
|
|
| T |
3529876 |
gtgagctctagccactagactac |
3529898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 11745190 - 11745304
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| ||||||||||| | || || ||||||||||||||| | ||||||||||| ||| | | ||||| || |
|
|
| T |
11745190 |
gtgaatttagctcagttggtagagatattgcattttatatgcaggggtcgggggtcgaaccccggacactctacttctccacaattaaattatgtgagct |
11745289 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
11745290 |
ctaaccactaggcta |
11745304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 120 - 237
Target Start/End: Original strand, 15694545 - 15694662
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||| |||||||||||||| || | |||| ||||||||||||| |||||||| ||| ||||| || |
|
|
| T |
15694545 |
ttatccccgtgagcttaattcagttggtagggatattgtatattatatgcaggggctg-ggtttgaaccccggacactccacttcttcacaatttaattg |
15694643 |
T |
 |
| Q |
219 |
tgtgaactctagccactag |
237 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
15694644 |
tgtggactctagccactag |
15694662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 120 - 237
Target Start/End: Original strand, 15701525 - 15701642
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||| |||||||||||||| || | |||| ||||||||||||| |||||||| ||| ||||| || |
|
|
| T |
15701525 |
ttatccccgtgagcttaattcagttggtagggatattgtatattatatgcaggggctg-ggtttgaaccccggacactccacttcttcacaatttaattg |
15701623 |
T |
 |
| Q |
219 |
tgtgaactctagccactag |
237 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
15701624 |
tgtggactctagccactag |
15701642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 129 - 219
Target Start/End: Complemental strand, 15716751 - 15716661
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| | | || ||||||||| |||||||||||||| | |||||||| |||| |
|
|
| T |
15716751 |
tgagtttagctcagttggtagggatattgcgtattatatgcaagggtcggggttcgaacttcggacaccccacttattcacatttaaatgt |
15716661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 39098132 - 39098254
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| | |||| | |||||||||| | || | | ||||||||| ||| | ||| |
|
|
| T |
39098132 |
tatccctgtgagcttagttcagttggtagggatattgcatattatatgcaagggccgggattcgaaccccaaatactctatttctccacaattaaattgt |
39098231 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
39098232 |
atgagctctagccactaggctac |
39098254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 241
Target Start/End: Original strand, 41853995 - 41854113
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||| |||||||| | |||||||| | || |||| ||||||||||||||| |||||||||||||| | |||| |
|
|
| T |
41853995 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcaggggacggagttcaaaccccggacaccccgcttctccacatttaattatgtg |
41854094 |
T |
 |
| Q |
223 |
aactctagccactaggcta |
241 |
Q |
| |
|
| ||||||||||| ||||| |
|
|
| T |
41854095 |
agctctagccactgggcta |
41854113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 10226672 - 10226793
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||||||||||||| || | |||||| | ||||||||||||||||||||| ||| | |||| |
|
|
| T |
10226672 |
atccccgtgagtttagttcagttggtagggatgttgcatattatatgcaggggctggagttcgagcttcggacaccccacttctccacaattaaattgtg |
10226771 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|| ||||| ||||||| |||| |
|
|
| T |
10226772 |
tgcgctctaaccactagactac |
10226793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 121 - 214
Target Start/End: Complemental strand, 23755088 - 23754995
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||| ||||| |||||||| | ||||||||||||||||||| |||||||| || ||| |||||||| | ||||||||||||||||| ||||| |
|
|
| T |
23755088 |
tatccccgtgagcttagctcaatcggtagggatattgcatattttatgcaggggctgagattcgaacctcagacaccccacttctccatattta |
23754995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 36389740 - 36389652
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| || ||||||||||| |||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
36389740 |
tatccccgtgagcttagctcagttggtagggatattgtattttatatgcaggggccggagttcgaactccggaca-cccacttctccaca |
36389652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 47543042 - 47542930
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| |||||||||||||||||| |||||||| | |||||||| ||| |||||||| |||||||| |||||||||||| ||||| | ||||| |||| |
|
|
| T |
47543042 |
tgagcttagctcagttggtaggggcattgcataatttatgcaggggccagggttcgaatcccggaca-cccacttctccatatttaattttgtgagctct |
47542944 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47542943 |
agccactaggctac |
47542930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 126 - 242
Target Start/End: Original strand, 4611240 - 4611355
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaac |
225 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| | |||| ||| || | |||||||||| | |||| |||||||||||||| ||| ||||||| | |
|
|
| T |
4611240 |
ctgtgagcttagctcagttggtagggacattgcataatttatgtaggggctggggttcgaaccacagaca-cccacttctccacaattaattgtgtgagc |
4611338 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
4611339 |
tctagccattaggctac |
4611355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 125 - 240
Target Start/End: Original strand, 7691872 - 7691987
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtga |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| | ||| |||| |||||||| ||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
7691872 |
cctgtgagtttagttcagttggtagggatattgcatattatgtatagg-gccggagttcgaactccggacattccacttctccacaatttaattgtgtga |
7691970 |
T |
 |
| Q |
224 |
actctagccactaggct |
240 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
7691971 |
gctctagtcactaggct |
7691987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 7779063 - 7778955
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||||||| |||||| |||| ||| | |||||| | |||| ||||||||||||||||| ||||||||||||||||| ||||||| || |
|
|
| T |
7779063 |
gtgagcttagctcagttgatagggacattgtataatttatgcaagtgccggagttcgaaccccggacactccacttctccacatttaattgtgtgagttc |
7778964 |
T |
 |
| Q |
228 |
tagccacta |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
7778963 |
tagccacta |
7778955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 10690857 - 10690965
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| | || ||||||||||| |||||||||||||||||| ||| | ||||||| | ||||||| |
|
|
| T |
10690857 |
tagctcagctgatagggatattgcatattatatgcaggggtcggagttcgaaccccaaacaccccacttctccacaattaaattgtgtgagcactagcca |
10690956 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||| ||||| |
|
|
| T |
10690957 |
ctatgctac |
10690965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 12935753 - 12935857
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||| ||||| |||||||| | |||| ||| | | |||||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
12935753 |
ctcagttggcagggacattgcataatttatgtaggggatggggttcgaaccccagacgccccacttctccacatttaattgtgtgagctctagccactag |
12935852 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
12935853 |
gctac |
12935857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 223
Target Start/End: Original strand, 22774038 - 22774138
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| |||||||| ||| ||||| |||||||| | |||||||| || | ||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22774038 |
tccccgtgagcttagctcaattgacagggacattgcataatttatgcaggggcaggggttcaaaccccggacaccccacttctccacatttaaatgtgtg |
22774137 |
T |
 |
| Q |
223 |
a |
223 |
Q |
| |
|
| |
|
|
| T |
22774138 |
a |
22774138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 31191656 - 31191552
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||||||||||||| |||||||| |||| ||| | ||||||| |||||||||||| |
|
|
| T |
31191656 |
tcagttggtaaggatattgcatattatatgcagggatcggagttcgaaccccggacactccacttctgcacaattaaattgtgtgagctctagccactaa |
31191557 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
31191556 |
gctac |
31191552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 38643384 - 38643276
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||| ||||||| | ||||| ||||||||||| ||| | | |||| |||||||| ||||||||||||| |||||||||| |||||| ||||||||| |
|
|
| T |
38643384 |
ttagctcggttggtatgaatatttcatattatatgtaggggttggggtttgaaccccgaacaccccacttcttcacatttatacgtgtgagctctagcca |
38643285 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|| |||||| |
|
|
| T |
38643284 |
ctgggctac |
38643276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 119 - 202
Target Start/End: Complemental strand, 25318612 - 25318529
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
|||||||| |||||| ||| ||| |||||||||||||||||| ||||||| |||||||| ||||||||||||| |||| ||||| |
|
|
| T |
25318612 |
tttatccccgtgagtctagttcaattggtagggatattgcattttatatgtaggagccggggttcgaaccccgaacactccact |
25318529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 37411805 - 37411718
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||| | |||||||| | || ||| |||| |||||||||||||||||||||||||| |
|
|
| T |
37411805 |
tgtgagtttagctcaattggtagggacattgcataatttatgcaggggtcggagtttgaactccggacaccccacttctccacattta |
37411718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 38824701 - 38824579
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatg |
218 |
Q |
| |
|
|||||| | ||||| |||||||||||| |||||||||||| ||||||||||||| | | ||||||||||||||||||| | || |||| || ||| || |
|
|
| T |
38824701 |
tttatctccgtgagcttagctcagttgatagggatattgcgtattatatgcaggggtcaaggttcgaaccccggacactctacctctctgcaattaaat- |
38824603 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| || ||||||||||||||| |
|
|
| T |
38824602 |
tgtgagctttagccactaggctac |
38824579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 42182265 - 42182150
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||||| |||||||||||||||||||| | || ||||||||| |||||||| ||||| |||||| ||||| ||| ||| || |
|
|
| T |
42182265 |
gtgagcttaactcagttggtaggggtattgcatattatatgcaggggtcggggttcgaactccggacactccactcctccacaatttaattgtatgagct |
42182166 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||| |||||| |||| |
|
|
| T |
42182165 |
ctagtcactagactac |
42182150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 46758253 - 46758360
Alignment:
| Q |
137 |
gctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||| | || ||||||||| |||||||||||||| |||||||||| | |||||||| ||| |||||| |
|
|
| T |
46758253 |
gctcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaactccggacaccccactcctccacatttaaaatgtgtgagctccagccac |
46758352 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
46758353 |
taggctac |
46758360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 230
Target Start/End: Original strand, 48447752 - 48447855
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||| ||||| |||| ||||||||||| |||| |||||||||||| ||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
48447752 |
gtgagcttaactcagttggtagagatatcgcattttatatgcaggggccggggttcgaaccccagacactccacttctccacaattaaattgtgtgagct |
48447851 |
T |
 |
| Q |
227 |
ctag |
230 |
Q |
| |
|
|||| |
|
|
| T |
48447852 |
ctag |
48447855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 12615755 - 12615869
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| ||| |||||||| |||||||||||||||||||||||||| | | | ||||||| ||||||||||| |||||||||| ||| | ||||||| ||| |
|
|
| T |
12615755 |
tgagcttaactcagttgatagggatattgcatattatatgcaggggttgggattcgaactccggacaccccgcttctccacaattaaattgtgtgagctc |
12615854 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| ||||||| |||| |
|
|
| T |
12615855 |
taaccactagactac |
12615869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 125 - 242
Target Start/End: Complemental strand, 24732621 - 24732503
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtga |
223 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||| || || | ||||||||| | ||||| ||||||||||||| ||| | ||||||| |
|
|
| T |
24732621 |
cctgtgagcttagctcagttgttagggatattgcatattatatgtagaagttggggttcgaacgcatgacactccacttctccacaattaaattgtgtga |
24732522 |
T |
 |
| Q |
224 |
actctagccactaggctac |
242 |
Q |
| |
|
||||||||| ||| |||| |
|
|
| T |
24732521 |
gctctagccattagactac |
24732503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 237
Target Start/End: Original strand, 27425106 - 27425200
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||| |||||||| | |||||||| || | |||||||||||||||||||| |||||| |||||||| |||||| ||||||||||||| |
|
|
| T |
27425106 |
ttggtagggacattgcataatttatgcaggggcagtggttcgaaccccggacacccgacttcttcacatttaatcgtgtgagctctagccactag |
27425200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 34051941 - 34051860
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| || | || ||||||||| |||||||||||||||||| |
|
|
| T |
34051941 |
gtgagtttagttcagttggtagtgatattgcatattatatgcaggggctg-ggatcgaaccccatacaccccacttctccaca |
34051860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 234
Target Start/End: Complemental strand, 35612633 - 35612527
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||||||||||| | | |||| ||||||||||||| ||||||||||||| ||| | ||| ||||||| |
|
|
| T |
35612633 |
tgagcttagctcaattggtagggagattgcatattatatgcagaggttggggtttgaaccccggacactccacttctccacaattaaattgtatgaactc |
35612534 |
T |
 |
| Q |
228 |
tagccac |
234 |
Q |
| |
|
||||||| |
|
|
| T |
35612533 |
tagccac |
35612527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 41084042 - 41084104
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | || |||||||||||| |
|
|
| T |
41084042 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacccc |
41084104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 25155545 - 25155658
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| |||| |||||||| | |||| |||||||| |||||||| || ||||||||||| |||||||||||||||||||||||| ||||||| || | |
|
|
| T |
25155545 |
tgagcttagttcagttggcaaagataatgcatattttatgcagggttcggggttcgaaccctggacaccccacttctccacatttaattgtgtgagctgt |
25155644 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
25155645 |
agccactagcctac |
25155658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 189
Target Start/End: Original strand, 36720110 - 36720171
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccc |
189 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||| | ||||||||||| |
|
|
| T |
36720110 |
gtgagcttagctcagttggtagggatattgcatattatatacaggagctggggttcgaaccc |
36720171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 223
Target Start/End: Complemental strand, 40518950 - 40518861
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||| ||| | | | ||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
40518950 |
ttagctcagttggtagggacattgcataatatatgtaggggttgggattcgaactccggacaccccacttctccacatttaattgtgtga |
40518861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 2846121 - 2846013
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||| |||||||||||||| | ||||| ||| | | ||||||||||| ||||||||||||||||||||||| | ||||| ||||| ||| |
|
|
| T |
2846121 |
ttagctcagttgatagggatattgcatgtaatatgtaggggttggggttcgaacccaagacaccccacttctccacatttaattatgtgatctctatcca |
2846022 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
2846021 |
ctagactac |
2846013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 218
Target Start/End: Original strand, 19828135 - 19828219
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatg |
218 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| | || ||||||||||| ||| || ||||||||||||| ||||||| |
|
|
| T |
19828135 |
ttagctcagttggtagggatatcgcattttatatgcagaggtcggggttcgaaccctggatactccacttctccacaattatatg |
19828219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 214
Target Start/End: Complemental strand, 20101725 - 20101633
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||||||||| |||||||||| ||| | ||||||||||||||||| |||| ||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
20101725 |
tccccgtgagtttagatcagttggtatggacaaatgcatattatatgcaggggccggggttcgaactccggacaccctacttctccatattta |
20101633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 28735730 - 28735846
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||| | | | || | ||||||||| ||| ||||| |||||||| || ||| | ||||||| | |
|
|
| T |
28735730 |
tgtgagcttaactcagttggtagggatattgcatattataagtaagggctggggttcgaactccgaacaccatacttctcctcaattaaattgtgtgatc |
28735829 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28735830 |
tctagccactaggctac |
28735846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 29281410 - 29281294
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaac |
225 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||| |||||| |||| | || ||||||||| |||||| | ||||||||||||| ||| | ||||||| | |
|
|
| T |
29281410 |
gtgagcttaactcagttgatagggatattgcatatttatatccaggggtcggggttcgaacaccggacgctccacttctccacaattaaattgtgtgagc |
29281311 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
29281310 |
tctagccactagactac |
29281294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 34891208 - 34891326
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt---atatgtgtga |
223 |
Q |
| |
|
||||||| |||||||||||||||| | ||||| ||||||||||| |||| ||||||||| |||||||||||||||||||| |||| | |||||||| |
|
|
| T |
34891208 |
gtgagttgtgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaactccggacaccccacttctccatatttaaaaaatgtgtga |
34891307 |
T |
 |
| Q |
224 |
actctagccactaggctac |
242 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
34891308 |
gttctagccactagactac |
34891326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 45640164 - 45640044
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgt |
221 |
Q |
| |
|
|||| ||||| ||| || |||| |||||||||||| ||||||||||||||| | | ||||||||| |||||||| ||||||||| | | ||| | ||||| |
|
|
| T |
45640164 |
tccccgtgagcttaacttagttagtagggatattgtatattatatgcaggaactggggttcgaactccggacactccacttctctataattaaattgtgt |
45640065 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||| ||||||||||| |
|
|
| T |
45640064 |
gagctctagtcactaggctac |
45640044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 196
Target Start/End: Complemental strand, 47255149 - 47255081
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||| ||| ||||||||| || ||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
47255149 |
gtgagcttaactcagttggcagagatattgcatattatctgcaggagccggggttcgaaccccggacac |
47255081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 138 - 241
Target Start/End: Complemental strand, 7836993 - 7836890
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||| |||||| |||| ||| | |||||||| || ||||||||| ||| |||| ||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
7836993 |
ctcagttgatagggacattgtataatttatgcagggatcggggttcgaactccgaacacaccacttctccacatttaattgtgtgagctctagccactag |
7836894 |
T |
 |
| Q |
238 |
gcta |
241 |
Q |
| |
|
|||| |
|
|
| T |
7836893 |
gcta |
7836890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 19331570 - 19331452
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||| ||||||||| ||||||||||| ||||||||||||| | |||| | ||||||||| ||||||||||||| |||| |||| |
|
|
| T |
19331570 |
atccccgtgagcttagtgcagttggtacggatattgcattttatatgcaggagttgtggtttg---cccggacactccacttctccacaatttaattgtg |
19331474 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
19331473 |
tgagctctagccactaggctac |
19331452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 48674629 - 48674514
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||| |||||||| || ||||||||||| ||||||||||| | | ||||| |||||||||||| ||||||||||| | ||| | ||||||| || |
|
|
| T |
48674629 |
gtgagtttaactcagttgataaggatattgcattttatatgcaggggttggggttcaaaccccggacactccacttctccataattaaattgtgtgagct |
48674530 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||| |||||| |||| |
|
|
| T |
48674529 |
ctagtcactagactac |
48674514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 205
Target Start/End: Original strand, 3392465 - 3392547
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
|||| ||||| ||| |||||||| || ||||||||||||||||||| ||| | || |||||||||||| |||||||||||||| |
|
|
| T |
3392465 |
tccccgtgagcttaactcagttgatatggatattgcatattatatgtaggggtcggggttcgaaccccagacaccccacttct |
3392547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 135 - 241
Target Start/End: Original strand, 22548221 - 22548327
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||| ||| |||||||| | ||| |||| | | ||||||||||||| |||||||||||||||||||||| || |||| ||| |||||| |
|
|
| T |
22548221 |
tagctcagttggtaaggacattgcataatttatacaggggtcagggttcgaaccccgaacaccccacttctccacatttaattgcgtgagctccagccac |
22548320 |
T |
 |
| Q |
235 |
taggcta |
241 |
Q |
| |
|
|| |||| |
|
|
| T |
22548321 |
taagcta |
22548327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 206
Target Start/End: Original strand, 29625924 - 29626000
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||| |||||| | |||||||||| ||||| ||||||||| |
|
|
| T |
29625924 |
gtgagcttaactcagttggtagggatattgcatattatatgca-gagccgggattcgaacccc-gacactccacttctc |
29626000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 237
Target Start/End: Complemental strand, 47287931 - 47287821
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||| ||| ||||||| ||| || | | |||||||| ||||||| ||||||||||||| ||| | ||||||| | |
|
|
| T |
47287931 |
gtgagcttaactcagttggtagggatattacattttatatgtaggggcagggattcgaacctcggacactccacttctccacaattacattgtgtgagat |
47287832 |
T |
 |
| Q |
227 |
ctagccactag |
237 |
Q |
| |
|
||||||||||| |
|
|
| T |
47287831 |
ctagccactag |
47287821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 206
Target Start/End: Complemental strand, 9929978 - 9929893
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||||| || || |||||||||||||||||||||||| ||||||||||||| | || |||||||||||||| || ||||||||| |
|
|
| T |
9929978 |
tatccccgttagcttagctcagttggtagggatattgaatattatatgcagcggtcggtgttcgaaccccggatactccacttctc |
9929893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 148 - 237
Target Start/End: Original strand, 28059769 - 28059858
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||| |||||||| | |||||||| |||| ||||||||| | | |||||||| ||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
28059769 |
agggacattgcataatttatgcaggggccggggttcgaactctgaacaccccaattctccacatttaaatgtgtgagctcaagccactag |
28059858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 162 - 242
Target Start/End: Complemental strand, 28547814 - 28547733
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| || ||||||||||||| |||| ||| ||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
28547814 |
ttatatgcaggaggcggggttcgaaccccgtacactccatttctccacaattaaattgtgtgagctctagccactaggctac |
28547733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 166 - 242
Target Start/End: Complemental strand, 43119461 - 43119384
Alignment:
| Q |
166 |
atgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| | || ||||||||||| |||||||||||||||||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
43119461 |
atgcaggggtcggggttcgaaccctggacaccccacttctccacaattaaattgtgtgagctctagccactaggctac |
43119384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 47194498 - 47194377
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||| |||||| ||| || ||||| || ||| |||||||||||||||||| ||| |||| |
|
|
| T |
47194498 |
tatccctgtgagcatagctcagttgacagggatattgtataatatatgtagggatcggggttcaaatcccaaacaccccacttctccacaattaattgtg |
47194399 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
47194398 |
tgagttctagccactaggctac |
47194377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 10684 - 10608
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| | | | ||||||| ||| |||| ||||||||||||| |
|
|
| T |
10684 |
ttagcttagttggtagggatattgcatattatatgcaggggatgtgattcgaactccgaacactccacttctccaca |
10608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 208
Target Start/End: Complemental strand, 16961691 - 16961611
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||| | || | || ||||| ||||||| ||||||||||| |
|
|
| T |
16961691 |
gtgagtttagctcagttggtagggatattgtattttatatgcagaggtcgggatttgaaccacggacactccacttctcca |
16961611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 21285442 - 21285336
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||| ||||| | ||||| ||||||||||| |||| ||||||||||||||||||||||||| | ||| ||||| | ||||| |||||||| |
|
|
| T |
21285442 |
tagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcac-cttataag-gtgaattctagcca |
21285345 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
21285344 |
ctaggctac |
21285336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 230
Target Start/End: Original strand, 23817185 - 23817293
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||| ||||||| ||| | || ||||| |||||| |||||| | |||||||| |||| ||||| |
|
|
| T |
23817185 |
atccctgtgagcttaactcaattggtagggatattgcatgttatatgtaggggtcggggttcaaaccccaaacaccctatttctccacgtttaattgtgt |
23817284 |
T |
 |
| Q |
222 |
gaactctag |
230 |
Q |
| |
|
|| |||||| |
|
|
| T |
23817285 |
gagctctag |
23817293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 30004610 - 30004534
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| | || |||||||||| ||| ||| ||||||||||||| |
|
|
| T |
30004610 |
ttagctcagttggtagggatattacatattatatataggggtcggggttcgaacctcggccactccacttctccaca |
30004534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 206
Target Start/End: Complemental strand, 41913825 - 41913753
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||||||| | | |||||||||||||||||| ||||||||| |
|
|
| T |
41913825 |
ttagctcagttgatagagatattgcattttatatgcaggggtcagggttcgaaccccggacactccacttctc |
41913753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 239
Target Start/End: Complemental strand, 42798371 - 42798272
Alignment:
| Q |
140 |
cagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactagg |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||| || || | ||||||||| ||| |||||| |||||||||||||| | |||||||| || |||| |||||| |
|
|
| T |
42798371 |
cagtttgtagggatattgcatattatatgc-ggggctggggttcgaactccgaacacccgacttctccacatttaaaatgtgtgagctttagctactagg |
42798273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 43324576 - 43324679
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| || || ||||||| || ||||||| |||||| |||||| | |||||||| ||||||||||||| |
|
|
| T |
43324576 |
ctcagttggtagggatattatatattaaatgcaggggctaagtttcgaacgcctgacaccc-acttcttcacattaaaatgtgtgagctctagccactag |
43324674 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
43324675 |
actac |
43324679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 9697958 - 9697843
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| ||||||||| | | |||||||||| | ||||| |||||||| ||| ||||| ||||||| || |
|
|
| T |
9697958 |
gtgagtttagcttagttagtatggatattgcattttatatgcatgggataaggttcgaacatcagacactccacttctacacaatttaattgtgtgagct |
9697859 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9697858 |
ctagccactaggctac |
9697843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 214
Target Start/End: Original strand, 11692385 - 11692479
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc--ggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||| |||| |||||||| | |||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
11692385 |
atccccgtgagtttagctcagatggtagggatattacataatatatgcaagggccggagttcgaaccccaaacacaccccacttctctacattta |
11692479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 14204294 - 14204357
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||| ||| || | |||||||||| ||||||| ||||||||||||| |
|
|
| T |
14204294 |
tagggatattgcatattatatgtaggggctggggttcgaacctcggacactccacttctccaca |
14204357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 188
Target Start/End: Complemental strand, 26944232 - 26944169
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
188 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
26944232 |
cctgtgagtttagctcagccggtaggaatattgcatattatatgcaggggccggggtttgaacc |
26944169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 133 - 188
Target Start/End: Original strand, 27633939 - 27633994
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
188 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| | || |||||||||| |
|
|
| T |
27633939 |
tttagcttagttggtagggatattgcatattatatgcaggggtcggggttcgaacc |
27633994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 177
Target Start/End: Complemental strand, 37300172 - 37300117
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccg |
177 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggccg |
37300117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 47070381 - 47070262
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||||| ||| |||||||| | ||| |||| ||| ||||||||||| | ||| |||||||||| ||| ||| |||||| |
|
|
| T |
47070381 |
tccccgtgagcttagctcagttggtatggacattgcataatttatacagggaccggggttcgaaccctgaacatcccacttctctacaattaattgtgtg |
47070282 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| || ||||||||| ||||| |
|
|
| T |
47070281 |
agctttagccactaagctac |
47070262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 242
Target Start/End: Complemental strand, 21875674 - 21875580
Alignment:
| Q |
149 |
gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||||| | || ||||||||||||||||| |||||| |||| | ||| | ||||||| ||||| ||| |||||||| |
|
|
| T |
21875674 |
gggatattgcatattatatgcaggggtcggagttcgaaccccggacactccacttttccataattaaattgtgtgagctctaaccattaggctac |
21875580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Complemental strand, 28914979 - 28914897
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggag-ccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| ||| |||||||| ||||| |||||| ||||||||||||||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
28914979 |
tccctgggagattagctcacatggtaagggataatgcatattatatgcagggggccggggttcgaaccccggacaccccactt |
28914897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 141 - 234
Target Start/End: Original strand, 29238931 - 29239025
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||| || | |||||| ||||||||||| ||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
29238931 |
agttggtaggaatattgcattttatgtgcaggggcaggggttcgtaccccggacactccacttctccacaattaaattgtgtgagatctagccac |
29239025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 189 - 242
Target Start/End: Original strand, 4886902 - 4886955
Alignment:
| Q |
189 |
ccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| ||||||||||| |
|
|
| T |
4886902 |
ccggacaccccacttctccacatataattgtgtgaactctagacactaggctac |
4886955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 10901642 - 10901763
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagcc-gaggttcgaaccccggacaccccacttctccacatttat-atgtg |
220 |
Q |
| |
|
|||| |||||||||| ||||||| | ||| |||||||| | |||||||| | | |||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
10901642 |
tccccgtgagtttagttcagttgacatggacattgcataatttatgcaggggatagcggttcgaacccctaacaccccacttctccacatttataatgtg |
10901741 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| || ||||||||||| |
|
|
| T |
10901742 |
tgagctccagtcactaggctac |
10901763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 19126743 - 19126812
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| ||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
19126743 |
tagctcagttggtaggaacaatgcattattatatacaggggctgaggttcgaaccccggacaccccactt |
19126812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 21177706 - 21177598
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||| ||| |||| ||| ||||||||||||||||||||| | ||| | || ||||||||| | |||| ||||||||||| ||| | ||||||||||| |
|
|
| T |
21177706 |
tgtgagcttaactcaattgatagggatattgcatattatatacgggatc-gaagttcgaacctcaaacactccacttctccatattaaaatgtgtgaact |
21177608 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
||| |||||| |
|
|
| T |
21177607 |
ctatccacta |
21177598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 31475929 - 31475860
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||||||||||| || | |||||||||||| |||||||||||| |
|
|
| T |
31475929 |
tagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccactt |
31475860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 240
Target Start/End: Complemental strand, 31727858 - 31727746
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||||||||||||| | | || ||||||||| ||||||| |||||||||||| ||||| ||||||| || |
|
|
| T |
31727858 |
gtgagtttatctcagttggtaaagatatcgcatattatatgcaag-gtcggagttcgaaccacggacactccacttctccacaatttaattgtgtgagct |
31727760 |
T |
 |
| Q |
227 |
ctagccactaggct |
240 |
Q |
| |
|
| | |||||||||| |
|
|
| T |
31727759 |
caaaccactaggct |
31727746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 36316062 - 36315994
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
36316062 |
tagctcagttggtagg-ataatgcattattatatgcaggggccggggttcgaacctcggacaccccactt |
36315994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 216
Target Start/End: Complemental strand, 39956469 - 39956380
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||| | |||||| | || |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
39956469 |
tgtgagtttaattcaattggtaggaatattgcataatttatgcaagggcaatggttcgaacctctgacaccccacttctccacatttata |
39956380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 130 - 187
Target Start/End: Original strand, 49005471 - 49005528
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaac |
187 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
49005471 |
gagtttagctcagttgacacggatattgcatattatatgcaggggctgaggttcgaac |
49005528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 9684631 - 9684711
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| | || | ||||||||||| ||| |||||||| |||||||| |
|
|
| T |
9684631 |
ttagttcagttggtagggatatcacatattatatgcaggtgtcgtgtttcgaaccccgaacattccacttcttcacattta |
9684711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 211
Target Start/End: Original strand, 10646183 - 10646251
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacat |
211 |
Q |
| |
|
||||||||||||||||||||| |||||| | | | |||| ||||| |||||||||||||||||||||| |
|
|
| T |
10646183 |
ttggtagggatattgcatattttatgcaagggtaggggtttgaacctcggacaccccacttctccacat |
10646251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 205
Target Start/End: Complemental strand, 27704373 - 27704289
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttct |
205 |
Q |
| |
|
|||||| |||| ||| ||||||||||||| ||||||||||||||||||||| | | ||||||||| | |||||| |||||||| |
|
|
| T |
27704373 |
tatccccgtgaacttaactcagttggtaggaatattgcatattatatgcaggggttggggttcgaactctggacactccacttct |
27704289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 214
Target Start/End: Complemental strand, 28800078 - 28800002
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||| | |||||| | |||||||| || | |||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
28800078 |
ctcagttggtagggacaatgcataatttatgcaggggcaggggtttgaacccctgacaccccacttctctacattta |
28800002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 242
Target Start/End: Complemental strand, 29658333 - 29658255
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| | ||| ||||| | ||||| ||||||||||||||||| |
|
|
| T |
29658333 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcac-cttataag-gtgaattctagccactaggctac |
29658255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 34948113 - 34948218
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||| | | ||||| || |||||||| |||||||||||||||||||||||||||||| | ||| ||||| | ||||| |||||||| |
|
|
| T |
34948113 |
tagctcagttggtagg-acaatgcattatcatatgcagtggccgaggttcgaaccccggacaccccacttattcac-cttataag-gtgaattctagcca |
34948209 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
34948210 |
ctaggctac |
34948218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 36114398 - 36114294
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| | || |||||||||||| | | | |||||||||||||||| |||||||| ||||| ||| ||| |
|
|
| T |
36114398 |
ctcagttaataggggtattgcatattatatgcagcggtcggggttcgaaccccaaatatctcacttctccacatttaaatgtgtgagctctaaccattag |
36114299 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
36114298 |
actac |
36114294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 186
Target Start/End: Original strand, 36622183 - 36622235
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa |
186 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| | |||| |||||||| |
|
|
| T |
36622183 |
ttagctcaattggtagggatattgcatattatatgcatgggccggggttcgaa |
36622235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 38451857 - 38451975
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
|||||||||| ||||||||||| ||||| | ||||| ||||||||||| |||| |||||||| |||||||||||||||| | |||| ||||| | || |
|
|
| T |
38451857 |
tccctgtgagcatagctcagttgacagggacaatgcattgttatatgcaggggccggggttcgaatcccggacaccccacttattcaca-ttataag-gt |
38451954 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |||| |
|
|
| T |
38451955 |
gaattctagccactagactac |
38451975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 42352648 - 42352728
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| || |||||||||||||||| ||||| || |||||||||| ||| |||| ||||||||||| |||||||| |
|
|
| T |
42352648 |
tccccgtgagctttgctcagttggtagggacattgcctaatatatgcaggggccagggtttgaaccccggacgccccactt |
42352728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 202
Target Start/End: Complemental strand, 44662564 - 44662484
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
|||||||||| |||||||| | |||| |||||| ||||| | |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
44662564 |
tccctgtgagcttagctcactaggtaagggataatgcattatgtatgcaggggccggggttcgaaccccggacaccccact |
44662484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 49053996 - 49054084
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| |||| |||||||||| | ||||||||||||||||||||| | | |||||||||||| || |||||| || | |||||||| |
|
|
| T |
49053996 |
ctgtgagcttagttcagttggtacgaatattgcatattatatgcagggactggggttcgaaccccagagaccccattttttcacattta |
49054084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 2291581 - 2291518
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||| ||||||||||||||| | || ||||||||| | |||||| ||||||||||||| |
|
|
| T |
2291581 |
tagggatattacatattatatgcaggggtcggggttcgaacactggacactccacttctccaca |
2291518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 7465498 - 7465541
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
7465498 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
7465541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 22966021 - 22965978
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
22966021 |
tattatatgcaggggccgaggttcgaaccccagacaccccactt |
22965978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 209
Target Start/End: Complemental strand, 28602526 - 28602451
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| | | || | ||||||| ||||| || |||||||||||| |
|
|
| T |
28602526 |
ttagctcagttggtaggaatattacatattatatgcatgggtcgggtttcgaacaccggagactccacttctccac |
28602451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 40273821 - 40273896
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
40273821 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccactt |
40273896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 41853642 - 41853728
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| |||||||||||||||| || | ||||| ||||||||| ||| || ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
41853642 |
gtgagcttagctcagttggtagagacaaatgcatgttatatgcaagagtcggggttcgaaccc-ggacaccccacttctccgcattta |
41853728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 42435288 - 42435201
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||| ||| ||||| | | |||| | |||||||| |||| |||||||||||| || ||| |||||||||||||||| |
|
|
| T |
42435288 |
tgtgagtttagctcacttgaaagggacaatacataatttatgcaggggccggggttcgaaccccagatacctcacttctccacattta |
42435201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 42887186 - 42887229
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
42887186 |
tattatatgcaggggctgaggttcgaaccccggacaccccactt |
42887229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 44437888 - 44437845
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
44437888 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
44437845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 144 - 242
Target Start/End: Complemental strand, 4162050 - 4161952
Alignment:
| Q |
144 |
tggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||| |||||||| | |||||||| | || ||||||||||| ||||||||| ||||||||| |||||| ||| ||| |||||||||||||| |
|
|
| T |
4162050 |
tggtatggacattgcataatttatgcaggggtcggagttcgaaccccatacaccccacatctccacatatatatgcatgagctcgagccactaggctac |
4161952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 7876002 - 7876083
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| | |||||||| || ||||| ||| || ||||||||||||||||||| |
|
|
| T |
7876002 |
gtgagcttagctcagttggtagggacattgcataatttatgcagggatcg-ggttcaaactccagacaccccacttctccaca |
7876083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 22590675 - 22590744
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| | || |||||||| ||| |||||||||||||||||| |
|
|
| T |
22590675 |
tcagttggtagggacattgcatattatatacagaggtcggggttcgaa-cccagacaccccacttctccac |
22590744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 241
Target Start/End: Complemental strand, 25711226 - 25711114
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||| || |||||||| |||| ||| ||||| |||||||| ||| |||| |||||||||| |||||||||||||| | ||| |||||| |||||| | |
|
|
| T |
25711226 |
gtgagtataactcagttgatagg-ataatgcattattatatgtaggggccggggttcgaacctcggacaccccacttattcac-tttataaatgtgaatt |
25711129 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
25711128 |
ctatccactaggcta |
25711114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 27679077 - 27678995
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||||| | | | |||| | | |||||||||| |||||||||||| |
|
|
| T |
27679077 |
gtgagcttaactcagttggtatggatattgcatattatatgcaagggtccgggtttgtatcccggacaccgcacttctccaca |
27678995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 234
Target Start/End: Complemental strand, 44377124 - 44377006
Alignment:
| Q |
116 |
gaatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat |
215 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||| |||||| ||||||||||||||| | | |||||||| | ||| | |||| ||||||||||| |
|
|
| T |
44377124 |
gaatttatcgttgtgagcttaactcagttggtagagatattacatattatatgcagggatcaatgttcgaactttgaacatctcactactccacatttaa |
44377025 |
T |
 |
| Q |
216 |
atgtgtgaactctagccac |
234 |
Q |
| |
|
|| ||||||||||| |||| |
|
|
| T |
44377024 |
atttgtgaactctaaccac |
44377006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 234
Target Start/End: Complemental strand, 44385991 - 44385873
Alignment:
| Q |
116 |
gaatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat |
215 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||| |||||| ||||||||||||||| | | |||||||| | ||| | |||| ||||||||||| |
|
|
| T |
44385991 |
gaatttatcgttgtgagcttaactcagttggtagagatattacatattatatgcagggatcaatgttcgaactttgaacatctcactactccacatttaa |
44385892 |
T |
 |
| Q |
216 |
atgtgtgaactctagccac |
234 |
Q |
| |
|
|| ||||||||||| |||| |
|
|
| T |
44385891 |
atttgtgaactctaaccac |
44385873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 209
Target Start/End: Complemental strand, 4620955 - 4620898
Alignment:
| Q |
152 |
atattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| | |||| |||||||||||| |
|
|
| T |
4620955 |
atattgcatattatatgcaggactcgaggttcgaacctcaaacactccacttctccac |
4620898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 5073261 - 5073314
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||| ||||| ||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
5073261 |
tttatccccgtgagcttaactcagttggtagagatattgtatattatatgcagg |
5073314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 190
Target Start/End: Original strand, 15655708 - 15655769
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| ||||||||||| || |||||||||||| |
|
|
| T |
15655708 |
tgagcttagctcaattggtagggatattgcattttatatgcagggagcggggttcgaacccc |
15655769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 18677022 - 18677071
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18677022 |
tccctgtgagtttaactcagttggtatggacgttgcatattatatgcagg |
18677071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Complemental strand, 20527530 - 20527449
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| |||||||||||| ||||| | ||||| ||||||||||| |||| |||||||||||| ||||| ||||| |
|
|
| T |
20527530 |
tccctgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggccggagttcgaaccccgaacacctcactt |
20527449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 20558894 - 20558813
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| ||| || |||||||||| |||||| |||||||| |||| |
|
|
| T |
20558894 |
tgagtttagctcagttggtagggatattgtattttatatttagggatcggggttcgaaccttggacactccacttcttcaca |
20558813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 203
Target Start/End: Original strand, 37665774 - 37665819
Alignment:
| Q |
158 |
catattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
37665774 |
catattatatgcaggggccggggttcaaaccccggacaccccactt |
37665819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 242
Target Start/End: Original strand, 40200754 - 40200834
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||| ||||||||||| |||| | |||||||| || |||||||||||||| |
|
|
| T |
40200754 |
ttatatgcaggggccggggttcgaacccc-gacactccacttctccatatttaaaatgtgtgagcttcagccactaggctac |
40200834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 41699642 - 41699751
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| ||||| |||| || | | ||||| ||||||| ||||||||| | | ||| | ||||||| || |
|
|
| T |
41699642 |
gtgagcttagctcagttagtagggatattgcatatcatatgtaggaatcgggatccgaacaccggacaatccacttctctataattaaattgtgtgagct |
41699741 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
41699742 |
ctagccacta |
41699751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #216
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 42548085 - 42547980
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||| ||| || | |||||||||| ||||||| | ||||||||||| ||| | ||||||| |||| ||| || |
|
|
| T |
42548085 |
ctcagttggtaggaatattacattttatatgtaggggctggggttcgaacctcggacactctacttctccacaattaaattgtgtgagttctaaccatta |
42547986 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
42547985 |
ggctac |
42547980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #217
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 197
Target Start/End: Original strand, 46987086 - 46987155
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
||||| ||||||||||||||| ||| | |||||| |||||||| | ||| ||||||||||||||||||| |
|
|
| T |
46987086 |
gtgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgaaccccggacacc |
46987155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #218
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 11808038 - 11808113
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| |||||||| |||||||||| || |||| ||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
11808038 |
gtgagcttagctcaattggtagggacat-gcattgttatatgcaggggtcggggttcgaaccccggacaccccactt |
11808113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #219
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 216
Target Start/End: Original strand, 14707293 - 14707380
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||| |||||||| |||||| |||||| ||||| ||||||||||| | | ||||||||||||||||||||||||| | ||| |||||| |
|
|
| T |
14707293 |
tgagcttagctcatttggtaagggataatgcat-ttatatgcaggggttggggttcgaaccccggacaccccacttattcacctttata |
14707380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #220
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 237
Target Start/End: Original strand, 15020969 - 15021073
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||| | | | |||||||||||||||||| ||| || || || ||||| ||||| | |||||||| |
|
|
| T |
15020969 |
ttagctcagttgataggaatattgcatgttatatgcaagggttggggttcgaaccccggacactccatttttcgacaatttaattgtgtcagctctagcc |
15021068 |
T |
 |
| Q |
233 |
actag |
237 |
Q |
| |
|
||||| |
|
|
| T |
15021069 |
actag |
15021073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #221
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 168
Target Start/End: Complemental strand, 24062078 - 24062038
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24062078 |
gtgagcttagctcagttagtagggatattgcatattatatg |
24062038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #222
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 232
Target Start/End: Complemental strand, 24822885 - 24822774
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgt |
219 |
Q |
| |
|
||||||| ||||| |||||||| | ||||||||||| | ||||||||||| | || ||||||||| |||||||| |||| |||||||| ||| || | |
|
|
| T |
24822885 |
ttatccccgtgagcttagctcaacttgtagggatattatactttatatgcaggggtcggggttcgaacgccggacactccacgtctccacaattaaat-t |
24822787 |
T |
 |
| Q |
220 |
gtgaactctagcc |
232 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
24822786 |
gtgagctctagcc |
24822774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #223
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 203
Target Start/End: Complemental strand, 29461882 - 29461807
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggag-ccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||| |||||||||| | | |||||||||| || ||||||||||||| |
|
|
| T |
29461882 |
gtgagtttaactcagttggtagggacaatgcataatatatgcaggggtcggaggttcgaa-cctggacaccccactt |
29461807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #224
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 30644169 - 30644244
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| |||||||||||||||| | | ||||| |||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
30644169 |
gtgagtatagctcagttggtagg-acaatgcattattatatgcaggggccggtgttcgaaccccagacaccccactt |
30644244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #225
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 31762002 - 31762106
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| ||| || | ||||| || ||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
31762002 |
gtgagtttagctcaattggtagggatattgcatgatatatgtaggggctgtggttc-aaatccggacacctcacttct----atttaatatgtgtgaact |
31762096 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
| |||||||| |
|
|
| T |
31762097 |
ccagccacta |
31762106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #226
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 236
Target Start/End: Original strand, 34259710 - 34259766
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||| ||| ||||||||||| |||||||||| | |||||| |||||||||||| |
|
|
| T |
34259710 |
gttcgaactccgaacaccccacttatccacatttaaacgtgtgagctctagccacta |
34259766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #227
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 1046541 - 1046596
Alignment:
| Q |
113 |
tttgaatttatccctgtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||| |||| |||||| |||||| |
|
|
| T |
1046541 |
tttgaatttatccctgtgagtttaggtcagttagtaaagataatgcataatatatg |
1046596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #228
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 241
Target Start/End: Original strand, 1649159 - 1649265
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||||| ||| ||||||||||| ||||||||||||| | ||| || | | ||||| |||||||| |
|
|
| T |
1649159 |
tagctcagttggtagggatat-gcattgttttatgcaggggccagggttcgaaccctggacaccccacttattcaccttgaaaatggtgaattctagcca |
1649257 |
T |
 |
| Q |
234 |
ctaggcta |
241 |
Q |
| |
|
|||||||| |
|
|
| T |
1649258 |
ctaggcta |
1649265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #229
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 4232410 - 4232296
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
|||||| ||| |||| ||||||| ||||||||||||||||||||| | | ||||| ||||| |||||| |||||||| ||| |||| ||||||| | |
|
|
| T |
4232410 |
tgtgaggttaactcaattggtagagatattgcatattatatgcagaggtaggggttc-aaccctggacactccacttcttcacgtttaattgtgtgagtt |
4232312 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||| |||||| |||| |
|
|
| T |
4232311 |
ctagtcactagactac |
4232296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #230
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 5833037 - 5833084
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
5833084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #231
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 9233836 - 9233785
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
9233836 |
tatccccgtgagcttaactcagttggtagggatattgaattttatatgcagg |
9233785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #232
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 14102493 - 14102536
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
14102493 |
tattatatgcaggggccggggtttgaaccccggacaccccactt |
14102536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #233
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 14412510 - 14412553
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
14412510 |
tattatatgcaggggccggggtttgaaccccggacaccccactt |
14412553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #234
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 167
Target Start/End: Complemental strand, 16537597 - 16537558
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
16537597 |
gtgagtttagctcagttggtagggataatgcataatatat |
16537558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #235
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 167
Target Start/End: Original strand, 16628065 - 16628104
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
16628065 |
gtgagtttagctcagttggtagggataatgcataatatat |
16628104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #236
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 168
Target Start/End: Complemental strand, 20115642 - 20115603
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
20115642 |
tgagtttagctcagttggtagggacaatgcatattatatg |
20115603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #237
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 23685617 - 23685574
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
23685617 |
tattatatgcaggggccggggttcgaaccccagacaccccactt |
23685574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #238
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 26816730 - 26816683
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
26816683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #239
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 203
Target Start/End: Complemental strand, 28479375 - 28479320
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||| ||||||| |||||||||||| |
|
|
| T |
28479375 |
agggatattgcatattatatgaaagagccggagtttgaaccccagacaccccactt |
28479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #240
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 28501155 - 28501269
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||||||| ||||||||||| | ||||||||||||||||| || | |||||||| | || |||||||||||||||||| ||| | |||| |
|
|
| T |
28501155 |
atccccgtgagtttaactcagttggtatgaatattgcatattatatgtagcggttacggttcgaa-ctcgaacaccccacttctccacaattaaattgtg |
28501253 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| ||||| |||||| |
|
|
| T |
28501254 |
tgagctctaaccacta |
28501269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #241
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 32750014 - 32750133
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||| ||| ||||||| ||| |||||||| | |||||| | || | |||||||| | | ||||| ||||||||||| | ||| |||||| |
|
|
| T |
32750014 |
tccccgtgagcttaactctgttggtatggacattgcataatttatgcacgggcaggggttcgaatctcagacactccacttctccataattaattgtgtg |
32750113 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||||||| |||||||| |
|
|
| T |
32750114 |
agctctagccattaggctac |
32750133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #242
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 34960983 - 34960940
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
34960983 |
tattatatgcaggagccggggttcgaatcccggacaccacactt |
34960940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #243
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 38778742 - 38778699
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
38778742 |
tattatatgcaggggccgaggttctaaccccggacatcccactt |
38778699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #244
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 209
Target Start/End: Complemental strand, 39829223 - 39829152
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| || ||||||||||| ||||| | |||||||||| |
|
|
| T |
39829223 |
ctcagttggtaggaatattgcattttatatgcagggatcggtgttcgaaccccagacactcaacttctccac |
39829152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #245
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 40011732 - 40011787
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| | ||||||||||||||| | |||||||||||||||| ||| ||||||| |
|
|
| T |
40011732 |
agggataatacatattatatgcaggggtcgaggttcgaaccccgaacatcccactt |
40011787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #246
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 47880178 - 47880221
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
47880178 |
tattatatgcaggggccggggttcgaatcccggacaccccactt |
47880221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #247
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 48433805 - 48433730
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
48433805 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcaaaccccggacaccccactt |
48433730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #248
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 4232670 - 4232584
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||| |||| |||| || || |||||||| | |||| ||| || |||||||||||| | |||||||| |||||||||||||| |
|
|
| T |
4232670 |
gtgagcttaactcatttggcagtgacattgcataatttatgtaggggcagaggttcgaacctctgacaccccgcttctccacattta |
4232584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #249
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 197
Target Start/End: Original strand, 24991776 - 24991850
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| | |||||| |||||||| || || | ||||||| ||||||||| |
|
|
| T |
24991776 |
tccctgtgagcttagctcagttggtaaggacaatgcataatatatgcaagatacgggattcgaactccggacacc |
24991850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #250
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 207
Target Start/End: Original strand, 25149056 - 25149130
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa-ccccggacaccccacttctcc |
207 |
Q |
| |
|
|||||||| ||| |||||||||| ||| |||||||| || || | |||||||| |||| |||||||||||||||| |
|
|
| T |
25149056 |
ttagctcatttgttagggatattacattttatatgcgggggctggggttcgaacccccagacaccccacttctcc |
25149130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #251
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 242
Target Start/End: Original strand, 26122078 - 26122148
Alignment:
| Q |
173 |
agccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| ||||| | | |||||||| |
|
|
| T |
26122078 |
agccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctaactagtaggctac |
26122148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #252
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 200
Target Start/End: Complemental strand, 27047803 - 27047738
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
27047803 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaacctcggacacccca |
27047738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #253
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 203
Target Start/End: Complemental strand, 33202640 - 33202574
Alignment:
| Q |
138 |
ctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| ||||| |||| || |||||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
33202640 |
ctcagttggcagggacattgtattgttatatacaggggccggggttcgaaccccggacaccccactt |
33202574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #254
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 200
Target Start/End: Original strand, 35195850 - 35195915
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
|||||||||||| ||||| || |||| |||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
35195850 |
tagctcagttggcagggacat-gcattattatatgcaggggccggggttcgaaccccgaacacccca |
35195915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #255
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 41833018 - 41832976
Alignment:
| Q |
161 |
attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
41833018 |
attatatgcaggggccggggttcgaaccctggacaccccactt |
41832976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #256
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Complemental strand, 47607971 - 47607929
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
47607971 |
gtgagtttagctcagttggtagggacattacataatatatgca |
47607929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #257
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 2567893 - 2567852
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
2567893 |
ttatatgcaggggccggggttcgaaccccggtcaccccactt |
2567852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #258
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 199
Target Start/End: Complemental strand, 6973539 - 6973490
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacacccc |
199 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||| | |||||||| |
|
|
| T |
6973539 |
ggatattgcatattatatgcaggggctggggttcgaacctcagacacccc |
6973490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #259
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 206
Target Start/End: Complemental strand, 9489843 - 9489767
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||||||||||||||| ||| |||||| |||||||||| ||| | ||| ||||||| | |||||||| |||||||| |
|
|
| T |
9489843 |
tgagtttagctcagttgatagagatattacatattatatacagcggtcgaagttcgaa-ctcggacaccacacttctc |
9489767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #260
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 20421820 - 20421715
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagcc |
232 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| || | ||||||||||| |||| | ||||||||||||||| | |||||||| ||| | || |
|
|
| T |
20421820 |
ttagttcagttaatagggatattgcatattatatgcgggggatatggttcgaaccctagacatctcacttctccacatttaaaatgtgtgagctcgaacc |
20421721 |
T |
 |
| Q |
233 |
actagg |
238 |
Q |
| |
|
|||||| |
|
|
| T |
20421720 |
actagg |
20421715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #261
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 126 - 191
Target Start/End: Original strand, 21105601 - 21105666
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
191 |
Q |
| |
|
||||||| ||||||||||||||| ||| | |||||| |||||||| | |||||||||||||||| |
|
|
| T |
21105601 |
ctgtgagcttagctcagttggtatggaaaatgcataatatatgcaaggttcgaggttcgaaccccg |
21105666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #262
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 27245117 - 27245029
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| |||| |||||| ||||||||| |||||||| | ||||||| || | |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
27245117 |
tatccccgtgaacttagctaagttggtagagatattgctt-ttatatgtagaggttgaggttcgaatcccggacaccccaattctccaca |
27245029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #263
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 30847092 - 30847133
Alignment:
| Q |
196 |
ccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
30847092 |
ccccacttttccacattaaaatgtgtgaactctagccactag |
30847133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #264
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 242
Target Start/End: Original strand, 30991842 - 30991923
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||| || ||||||||||||| |||| ||||||||||||| ||| | ||| ||| ||||||||| ||||||| |
|
|
| T |
30991842 |
ttatatgtaggagtcggggttcgaaccccgaacactccacttctccacaattaaattgtatgagttctagccacaaggctac |
30991923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #265
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 126 - 167
Target Start/End: Complemental strand, 31170267 - 31170226
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||| |
|
|
| T |
31170267 |
ctgtgagtttagctcagttgatagagatattgcataatatat |
31170226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #266
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 32814834 - 32814902
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| || |||| |||||||||||| | || ||||||| |||||||||||||||| |
|
|
| T |
32814834 |
tagctcagttggtagggacat-gcattattatatgcaggggtcggagttcgaatcccggacaccccactt |
32814902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #267
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 41417364 - 41417295
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||| | | ||||| |||||||||||| | || |||||||||||| |||||||||||| |
|
|
| T |
41417364 |
tagctcagttggcaggaacagtgcatcattatatgcaggggtcggggttcgaaccccagacaccccactt |
41417295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #268
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 168
Target Start/End: Complemental strand, 42433156 - 42433119
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
42433156 |
agtttagcttagttggtagggatattgtatattatatg |
42433119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #269
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 203
Target Start/End: Complemental strand, 47324556 - 47324503
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| |||||| |||||||| |||| |||||||||||| | |||||||||||| |
|
|
| T |
47324556 |
ggataatgcataatatatgcatgagctgaggttcgaacctctgacaccccactt |
47324503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #270
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 47552220 - 47552288
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||| | |||| |||||||||||||||||||| |||| |
|
|
| T |
47552220 |
tagctcagttggtagg-acaatgcattattatatgcaagggccggggttcgaaccccggacaccctactt |
47552288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #271
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 48174962 - 48175042
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||| |||||||||||| | ||| || |||| ||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
48174962 |
tccccgtgagtatagctcagttggcaaggacat-gcattattatatacaggggccggtgttcgaaccccggacaccccactt |
48175042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #272
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 237
Target Start/End: Complemental strand, 48269400 - 48269343
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||| | ||||||| ||||||||||||| |
|
|
| T |
48269400 |
ttcgaatcccggacactccacttctccacaattaaattgtgtgagctctagccactag |
48269343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #273
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 210
Target Start/End: Complemental strand, 15639493 - 15639413
Alignment:
| Q |
130 |
gagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||||||||| || |||| ||||||||||| ||| | |||||||| |||| |||||||||||| ||||| |
|
|
| T |
15639493 |
gagtttaattcagttggtagagacattgtatattatatgctagagttggggttcgaatcccgtacaccccacttccccaca |
15639413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #274
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 22555627 - 22555695
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||||||| | || | |||||||||||| ||||| |
|
|
| T |
22555627 |
tgagtttagctcagttggtaaggacattgcataaaatatgcacggtccaaagttcgaaccccgaacacc |
22555695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #275
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 26130203 - 26130167
Alignment:
| Q |
174 |
gccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
26130203 |
gccgaggttcgaaccccgaacaccctacttctccaca |
26130167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #276
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 170
Target Start/End: Complemental strand, 27068212 - 27068176
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27068212 |
ttagctcagttggtatggataatgcatattatatgca |
27068176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #277
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 170
Target Start/End: Original strand, 27210101 - 27210137
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27210101 |
ttagctcagttggtatggataatgcatattatatgca |
27210137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #278
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 170
Target Start/End: Complemental strand, 30003237 - 30003201
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
30003237 |
ttagctcagttggtaaggatattacatattatatgca |
30003201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #279
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 194
Target Start/End: Complemental strand, 46570072 - 46570000
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggac |
194 |
Q |
| |
|
|||| ||||| |||||||| ||| || |||||| |||||| | |||||||| |||| |||||||||||||||| |
|
|
| T |
46570072 |
tccccgtgagcttagctcacttgataagggataatgcatagtttatgcaggggccggggttcgaaccccggac |
46570000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 319)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 1570266 - 1570144
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
1570266 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
1570167 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
1570166 |
gtgagctctagccactaggctac |
1570144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 6438138 - 6438016
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
6438138 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
6438039 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
6438038 |
gtgagctctagccactaggctac |
6438016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 13773164 - 13773286
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
13773164 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccacaattaaattgt |
13773263 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
13773264 |
gtgagctctagccactaggctac |
13773286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 15819674 - 15819553
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
15819674 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
15819575 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
15819574 |
tgagctctagccactaggctac |
15819553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 21265653 - 21265774
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtg |
21265752 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
21265753 |
tgagctctagccactaggctac |
21265774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 22563380 - 22563504
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatat |
217 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||| ||||| | |
|
|
| T |
22563380 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaatt |
22563479 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
22563480 |
gtgtgagctctagccactaggctac |
22563504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 34058217 - 34058332
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
34058217 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
34058316 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
34058317 |
ctagccattaggctac |
34058332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 118 - 242
Target Start/End: Complemental strand, 40519621 - 40519495
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagcc-gaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | |
|
|
| T |
40519621 |
atttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggggttcgaaccccggacactccacttctccacaattaaa |
40519522 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
40519521 |
ttgtgtgagctctagccactaggctac |
40519495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 46965736 - 46965858
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| | ||| | ||| |
|
|
| T |
46965736 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccataattaaattgt |
46965835 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
46965836 |
gtgagctctagccactaggctac |
46965858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 32594248 - 32594369
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtg |
32594347 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
32594348 |
tgagctctagccactaggctac |
32594369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 42490483 - 42490362
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
42490483 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccacaattaaattgtg |
42490384 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
42490383 |
tgaactctaaccactaggctac |
42490362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 2277757 - 2277872
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
2277757 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggagactccacttctccacaattaaattgtgtgagct |
2277856 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2277857 |
ctagccactaggctac |
2277872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 16343031 - 16343146
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
16343031 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
16343130 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
16343131 |
ctagccactaagctac |
16343146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 44732628 - 44732751
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||||||| ||| | || |
|
|
| T |
44732628 |
ttatccccgtgagcttaactcagttggtagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccacttctccacaattaaattg |
44732727 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
44732728 |
tgtgaactctagccactagactac |
44732751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 43884790 - 43884912
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||| ||| | ||| |
|
|
| T |
43884790 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaattgt |
43884889 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||| |||| |
|
|
| T |
43884890 |
gtgagttctagccactagactac |
43884912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 4482671 - 4482550
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||| ||| | |||| |
|
|
| T |
4482671 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggatactccacttctccacaattaaattgtg |
4482572 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
4482571 |
tgagctctagccactaggctac |
4482550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 7166300 - 7166179
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacactccacttctccacaatttaattgtg |
7166201 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
7166200 |
tgagctctagccactaggctac |
7166179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 121 - 237
Target Start/End: Original strand, 25999846 - 25999963
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
25999846 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgt |
25999945 |
T |
 |
| Q |
220 |
gtgaactctagccactag |
237 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
25999946 |
gtgagctctagccactag |
25999963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 118 - 242
Target Start/End: Complemental strand, 26584823 - 26584698
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata- |
216 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||| ||| ||| | |
|
|
| T |
26584823 |
atttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctctacaattaaat |
26584724 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
26584723 |
tgtgtgagctctagccactaggctac |
26584698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 29188630 - 29188754
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| || ||||||||||||| ||| | | |
|
|
| T |
29188630 |
tttatccccgtgattttagctcagttggtagggatattgcatattatatgcaggagcaggggttcgaaccccggatactccacttctccacaattaaatt |
29188729 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||||||||||| |||| |
|
|
| T |
29188730 |
gtgtgagctctagccactagactac |
29188754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 6893312 - 6893189
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||| |||||| ||| | || |
|
|
| T |
6893312 |
ttatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccacttttccacaattaaattg |
6893213 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||| ||||||||||||| |
|
|
| T |
6893212 |
tgtgagctctggccactaggctac |
6893189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 11215004 - 11215119
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||| |||||||||||| ||||| ||||||| || |
|
|
| T |
11215004 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacactccacttctccacaatttaattgtgtgagct |
11215103 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11215104 |
ctagccactaggctac |
11215119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 48638527 - 48638650
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||| ||||||||||| || | |||||||||||| ||||||||||||||||||| ||| | || |
|
|
| T |
48638527 |
ttatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaactg |
48638626 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
48638627 |
tgtgagctctagccactaggctac |
48638650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 52369600 - 52369715
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||||| | ||| | ||||||| || |
|
|
| T |
52369600 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccctggatactccacttctccataattaaattgtgtgagct |
52369699 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
52369700 |
ctagccactagactac |
52369715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 7180688 - 7180566
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||| | ||| |
|
|
| T |
7180688 |
tatccccgtgaggttagctcagttggtaggaatattgcatattatatgcaggggccggagttcgaaccccggacaccccacttctccacaattaaattgt |
7180589 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||| ||||||||||| |
|
|
| T |
7180588 |
gtgagctctagtcactaggctac |
7180566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 29204648 - 29204762
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| | |||||| ||||||||||||||| ||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
29204648 |
gtgagcttagctcagttggtagggacattgcataatttatgcaagagccgaggttcgaatcccagataccccacttctccacatttagttgtgtgaactc |
29204747 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29204748 |
tagccactaggctac |
29204762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 33207202 - 33207323
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | | | |||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaaataagttgtg |
33207301 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || ||||||||||||||| |
|
|
| T |
33207302 |
tgagctatagccactaggctac |
33207323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 33254725 - 33254846
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccggacactccacttctccacaattaaattgtg |
33254824 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| |||||||| |
|
|
| T |
33254825 |
tgagctctagccattaggctac |
33254846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 33274897 - 33275018
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccggacactccacttctccacaattaaattgtg |
33274996 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| |||||||| |
|
|
| T |
33274997 |
tgagctctagccattaggctac |
33275018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 12502314 - 12502206
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||| ||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
12502314 |
tagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaacccggacactccacttctccacaattaaattgtgtgagctctagcca |
12502215 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
12502214 |
ctaggctac |
12502206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 50899583 - 50899495
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccaca |
50899495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 1151754 - 1151877
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||| |||||||| |||| ||| | || |
|
|
| T |
1151754 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatacaggagccgggattcgaaccccggacactccacttcttcacaattaaattg |
1151853 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||| ||||||||||| |
|
|
| T |
1151854 |
tgtgagctctagtcactaggctac |
1151877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 18534004 - 18534119
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||| ||||| || |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
18534004 |
gtgagcttagctcagttggtagagatattgcatattatatgtaggagtcggggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
18534103 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
18534104 |
ctagccactaggctac |
18534119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 47469145 - 47469026
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||| |||||||| | |||||||| || |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47469145 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcaggggctgaggttcgaaccccggacaccccacttctccacatttaattgtgtg |
47469046 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||| |||||||||||| |
|
|
| T |
47469045 |
agctctaaccactaggctac |
47469026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 2352639 - 2352517
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||| ||| ||||||||||||||||||||||||||| |||||||| |||| |||| ||||||||||||| ||||| ||| |
|
|
| T |
2352639 |
tatccccgtgagcttagctcagttgatagagatattgcatattatatgcaggagccggggttcgaatcccgaacactccacttctccacaattatattgt |
2352540 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||| |||||||| |
|
|
| T |
2352539 |
gtgagctctagccagtaggctac |
2352517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 5190847 - 5190733
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||| ||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||| ||||| | || |
|
|
| T |
5190847 |
tgagcttagctcaattggtagggatatcgcatattatatgcaggggtcgaggttcgaaccccggacaccccacttctccacaattatattgtgtaagttc |
5190748 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5190747 |
tagccactaggctac |
5190733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 6463102 - 6462988
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||| || ||||||||||| |||| |||||||||||||||||| |||||||||||| ||||| | ||||||||| |
|
|
| T |
6463102 |
tgagcttagctcagttggtagggatattgtattttatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattatgtgaactc |
6463003 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6463002 |
tagccactaggctac |
6462988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 18467272 - 18467150
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||| || | |||||||||||| ||||| |||||||||||| ||||| ||| |
|
|
| T |
18467272 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgt |
18467173 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
18467172 |
gtgagctctagccactaggctac |
18467150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 36666643 - 36666529
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||||||| ||| ||||||| ||| |
|
|
| T |
36666643 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacaattaattgtgtgagctc |
36666544 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
36666543 |
tagccattaggctac |
36666529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 40375389 - 40375267
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| | ||||||||||| ||| | ||| |
|
|
| T |
40375389 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggtacgaaccccggacactctacttctccacaattaaattgt |
40375290 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| |||||||||||| |
|
|
| T |
40375289 |
gtgagctctaaccactaggctac |
40375267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 120 - 236
Target Start/End: Original strand, 2754355 - 2754472
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||| ||||||||||||||||||||||||||||| || |||| |||||||||||||||||||| ||||||||||| ||| | || |
|
|
| T |
2754355 |
ttatccccgtgagcttagcttagttggtagggatattgcatattatatgccggggccggggttcgaaccccggacaccctacttctccacaattaaattg |
2754454 |
T |
 |
| Q |
219 |
tgtgaactctagccacta |
236 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
2754455 |
tgtgagctctagccacta |
2754472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 6702573 - 6702694
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| |||||||| |||| ||| | |||| |
|
|
| T |
6702573 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttcttcacaattaaattgtg |
6702672 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| |||||||| |
|
|
| T |
6702673 |
tgagctctagccattaggctac |
6702694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 10664867 - 10664747
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca-gagtcggggttcgaaccccggacactccacttctccacaattaaattgta |
10664769 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
10664768 |
tgagctctagccactaggctac |
10664747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 6130109 - 6129985
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||| ||||||||||||| ||| | | |
|
|
| T |
6130109 |
tttatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaactccggacactccacttctccacaattaaatt |
6130010 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||| |||||||| |
|
|
| T |
6130009 |
gtgtgagctctagccgttaggctac |
6129985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 8984572 - 8984458
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
8984572 |
gtgagcttaactcagttggcagggatattgcatattatatgcaggagccggggttcgaa-cccggacactccacttctccacaattaaattgtgtgagct |
8984474 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8984473 |
ctagccactaggctac |
8984458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 19564224 - 19564106
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||||||||||||||||| | ||| |||||||| | |||||||| |||| |||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
19564224 |
tccccgtgagtttagctcagttggcaaggacattgcataatttatgcagg-gccggggttcgaacctcggacaccccacttctccacatttaattgtgtg |
19564126 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
19564125 |
aactctagccattaggctac |
19564106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 31401312 - 31401198
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||||||| |||||| |||||||| | ||||||||||||||||||| ||||||||||||||||| |||||||| ||| ||||||| ||| |
|
|
| T |
31401312 |
gtgagcttagctcagttgatagggacattgcataatttatgcaggagccgaggttcaaaccccggacaccccacgtctccacaattaactgtgtgagctc |
31401213 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
31401212 |
taaccactaggctac |
31401198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 35605697 - 35605575
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| | || ||||||||||| |||||||||||||||||| ||| | ||| |
|
|
| T |
35605697 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctaaacaccccacttctccacaattaaattgt |
35605598 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||| |||||||||| |
|
|
| T |
35605597 |
gtgagctctagctactaggctac |
35605575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 7191041 - 7191150
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| || | ||||||||||||||||||| |||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
7191041 |
ttagctcagttgatagggatattgcatattatatgcaggggctggggttcgaaccccggacacctcacttctccacaattaaattgtgtgagctctagcc |
7191140 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
7191141 |
actagcctac |
7191150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 16526250 - 16526129
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||| ||| | |||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcaggagcctgtgttcgaaccccgtacactccacttctccacaattaaattgtg |
16526151 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
16526150 |
tgagctctaaccactaggctac |
16526129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 18216902 - 18217023
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| |||||| |||||| |||||| |||||||||||||||||| ||||||||| ||| ||| | ||| |
|
|
| T |
18216902 |
tatccccgtgagcttagctcagttggtagggatattacatattttatgcaagagccggggttcgaaccccggacactccacttctctacaattaaattgt |
18217001 |
T |
 |
| Q |
220 |
gtgaactctagccactaggcta |
241 |
Q |
| |
|
|||| |||||||||||| |||| |
|
|
| T |
18217002 |
gtgagctctagccactaagcta |
18217023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 11333673 - 11333781
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||| |||||||| | |||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||| |||||| || |
|
|
| T |
11333673 |
ttagctcagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccacatttaattgtgtgagctctagtca |
11333772 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
11333773 |
ctagactac |
11333781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 11491694 - 11491802
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||| |||||||| | |||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||| |||||| || |
|
|
| T |
11491694 |
ttagctcagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccacatttaattgtgtgagctctagtca |
11491793 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
11491794 |
ctagactac |
11491802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 1247253 - 1247372
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||||||||| ||| |||||||| || |||||||||||| | |||||||| | ||||||||||||||| |||||| |||||||||||||||| ||| || |
|
|
| T |
1247253 |
tccctgtgagcttaactcagttgataaggatattgcataatttatgcaggggtcgaggttcgaaccccagacacctcacttctccacatttaattgtttg |
1247352 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
1247353 |
agctctagccactaggctac |
1247372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 236
Target Start/End: Complemental strand, 13538507 - 13538404
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
13538507 |
ttagttcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagttctagcc |
13538408 |
T |
 |
| Q |
233 |
acta |
236 |
Q |
| |
|
|||| |
|
|
| T |
13538407 |
acta |
13538404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 19011358 - 19011473
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||| || | |||||||||||| || || |||||||||||| ||||| ||||||| || |
|
|
| T |
19011358 |
gtgagcttagctcaattggtagggatattgcatattatatgcaggggctggggttcgaaccccagatactccacttctccacaatttaattgtgtgagct |
19011457 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
19011458 |
ctagccactaggctac |
19011473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 125 - 240
Target Start/End: Complemental strand, 23991334 - 23991219
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaa |
224 |
Q |
| |
|
|||||||| || ||||||||| ||||| |||||||| | |||||||| |||| ||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
23991334 |
cctgtgagcttgactcagttggcagggacattgcataatttatgcaggggccggggttcgaaccctggacaccccacttctccacatttaattgtgtgag |
23991235 |
T |
 |
| Q |
225 |
ctctagccactaggct |
240 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23991234 |
ctctagccactaggct |
23991219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 26550489 - 26550611
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| || |||||||||| ||| | || |
|
|
| T |
26550489 |
ttatccccgtgagcttaactcagttggtagggatattgcatactatatgcaggagccggggttcgaaccccggacactcc-cttctccacaattaaattg |
26550587 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||| | ||||| |||||||||||| |
|
|
| T |
26550588 |
tgttagctctaaccactaggctac |
26550611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 2556552 - 2556674
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| || || ||||||||||||||||||||||||||||||||||||||| || | |||||||||||| |||| ||| ||||| || ||||| ||| |
|
|
| T |
2556552 |
tatccccgtaagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacattccatttctctacaatttaattgt |
2556651 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2556652 |
gtgaactctagccactaggctac |
2556674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 120 - 241
Target Start/End: Complemental strand, 23545529 - 23545408
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| | |||| ||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||| ||| | || |
|
|
| T |
23545529 |
ttatccccgtgagctaagcttagttggtagggatattgcatattatatgcaggagctgaggttcgaa-cccagacaccccacttctccacgattaaattg |
23545431 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||| ||||||| ||||||||| |
|
|
| T |
23545430 |
tgtgagctctagcaactaggcta |
23545408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 24874974 - 24875088
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | |||||| | || | |||||||||| ||||||||||||||||||| ||||| ||||||| ||| |
|
|
| T |
24874974 |
gtgagcttagctcagttggtagggatattgcataatttatgcatgggcaggggttcgaacctcggacaccccacttctccatatttaattgtgtgagctc |
24875073 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24875074 |
cagccactaggctac |
24875088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 120 - 241
Target Start/End: Complemental strand, 39347053 - 39346932
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||| ||||||||| ||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
39347053 |
ttatccccgtgagcttagcttagttggtagt-atattgcattttatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattg |
39346955 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
39346954 |
tgtgagttctagccactaggcta |
39346932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 121 - 214
Target Start/End: Original strand, 8780765 - 8780857
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||| | ||| ||||||||||| ||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
8780765 |
tatccctgtg-gcttaactcagttggtacggatattgcatattatatgcaggggccgaggttcaaacctcggacaccccacttctccacattta |
8780857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 8865851 - 8865972
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| | || | ||||||||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
8865851 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcgggattcgaaccctggacactccacttctccacaatttaattgtg |
8865950 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| ||||||||||||| |
|
|
| T |
8865951 |
tgagttctggccactaggctac |
8865972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 17671483 - 17671362
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| |||| | ||||||||| |||| ||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
17671483 |
atccccgtgagcttagctcagttggtagggatatcgcatttcatatgcaggggccggagttcgaaccccggacactccacttctccacaattaaattgtg |
17671384 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || ||||||||||||||| |
|
|
| T |
17671383 |
tgagctttagccactaggctac |
17671362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 18551706 - 18551585
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |||| |||| |||||||| |||| ||||||||||||| ||| | |||| |
|
|
| T |
18551706 |
atccccgtgagcttagctcagttggtatggatattgcatattatatgcaggggccggggtttgaaccccgaacactccacttctccacaattaaattgtg |
18551607 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|| ||||| |||||||||||| |
|
|
| T |
18551606 |
cgagctctaaccactaggctac |
18551585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 45333784 - 45333664
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||| |||||||||||||| |||||||||| || | |||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcata-tatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaattgtg |
45333686 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
45333685 |
tgagctctagccactaggctac |
45333664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 46161189 - 46161108
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggagccgatgttcgaaccccgaacactccacttctccaca |
46161108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 51050187 - 51050308
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| |||||||||||||| | | |||||||||||| |||| |||||||||||| ||||| |||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcaggggatggggttcgaaccccagacattccacttctccacaatttaattgtg |
51050286 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
51050287 |
tgagctctagccactaggctac |
51050308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 143 - 242
Target Start/End: Complemental strand, 12048176 - 12048076
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||||||||||||| |||||||||||||| || | |||||||| ||||||||||||||||||||||| ||| | ||||||| ||||||||||||||||| |
|
|
| T |
12048176 |
ttggtagggatattgtatattatatgcaggggctggggttcgaatcccggacaccccacttctccacaattaaattgtgtgagctctagccactaggcta |
12048077 |
T |
 |
| Q |
242 |
c |
242 |
Q |
| |
|
| |
|
|
| T |
12048076 |
c |
12048076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 114 - 210
Target Start/End: Original strand, 12404345 - 12404440
Alignment:
| Q |
114 |
ttgaatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||| ||||| |||| ||| |||||||||||||||||||||||||||||| || | ||||||||||||| |||||||||||||||||| |
|
|
| T |
12404345 |
ttgaatttatccccgtgagattagatcaattggtagggatattgcatattatatgcagg-gctggggttcgaaccccgaacaccccacttctccaca |
12404440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 138 - 241
Target Start/End: Complemental strand, 27579531 - 27579427
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| ||||||||| |||||||||||| | |||||||| |||||||||||| |
|
|
| T |
27579531 |
ctcagttggtatggatattacatattatatgcaggggccgaagttcgaaccctagacaccccatttctccacatttaaaatgtgtgagctctagccacta |
27579432 |
T |
 |
| Q |
237 |
ggcta |
241 |
Q |
| |
|
||||| |
|
|
| T |
27579431 |
ggcta |
27579427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 129 - 241
Target Start/End: Complemental strand, 31124704 - 31124592
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| ||||||||||||| | ||| |||||||| | |||||||| |||| ||||||||| ||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
31124704 |
tgagcttagctcagttggcaaggacattgcataatttatgcaggggccggggttcgaactccggataccccacttctccacatttaattgtgtgagctct |
31124605 |
T |
 |
| Q |
229 |
agccactaggcta |
241 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31124604 |
agccactaggcta |
31124592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 125 - 229
Target Start/End: Complemental strand, 34562857 - 34562753
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaa |
224 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| |||| | ||| |||| ||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
34562857 |
cctgtgagcttaactcagttggtagggatattacataatttatacaggggccgaggttcgaaccccggacaccccacttctccatatttaattgtgtgag |
34562758 |
T |
 |
| Q |
225 |
ctcta |
229 |
Q |
| |
|
||||| |
|
|
| T |
34562757 |
ctcta |
34562753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 47930731 - 47930623
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || | |||||||||| |||| ||||||||||| |||| ||| | ||||||| ||||| ||| |
|
|
| T |
47930731 |
tagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacctcggataccccacttcttcacaattaaattgtgtgagctctaacca |
47930632 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
47930631 |
ctaggctac |
47930623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 6712176 - 6712061
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| ||||||||||| |||| ||||| |||||||||||| | ||||||||||| ||| | | ||||| || |
|
|
| T |
6712176 |
gtgagcttagctcagttggtaggtatattgcattttatatgcaggggccggggttcaaaccccggacactctacttctccacaattaaattatgtgagct |
6712077 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6712076 |
ctagccactaggctac |
6712061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 9866251 - 9866136
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | || |||||||| |||| |||| |||||| |||||| ||| | ||||||| || |
|
|
| T |
9866251 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccgaacactccacttttccacaattaaattgtgtgagct |
9866152 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
9866151 |
ctagccactagactac |
9866136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 36314039 - 36313932
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccac |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |||||||||||| |||||||||||||||||||| |||||||| ||| | |||| |
|
|
| T |
36314039 |
tagctcagttggtagggatattgcatattatttgcaggggccggagttcgaaccccgaacaccccacttctccacattataatgtgtgagctccaaccac |
36313940 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
||| |||| |
|
|
| T |
36313939 |
tagactac |
36313932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 37662624 - 37662509
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | || ||| |||||||||||||||||||||||| ||| ||| | ||||||| || |
|
|
| T |
37662624 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggtacgaaccccggacaccccacttctctacagttaaattgtgtgagct |
37662525 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
| | ||||||| |||| |
|
|
| T |
37662524 |
ccaaccactagactac |
37662509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 45517335 - 45517220
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| |||||| |||| |||| | || ||||||||||||| |||||||||||| ||||| ||||||| || |
|
|
| T |
45517335 |
gtgagcttagttcagttggtagggatattgcattttatatacaggggccgggattggaaccccggacactccacttctccacaatttaattgtgtgagct |
45517236 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45517235 |
ctagccactaggctac |
45517220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 138 - 240
Target Start/End: Original strand, 51942308 - 51942410
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| | || ||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
51942308 |
ctcagttggtagggatattgcatattatatacagg-gtcggggttcgaaccccggacaccccacttctccacaatttaattgtgtgagctctagccactg |
51942406 |
T |
 |
| Q |
237 |
ggct |
240 |
Q |
| |
|
|||| |
|
|
| T |
51942407 |
ggct |
51942410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 52426980 - 52426866
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatg-tgtgaact |
226 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||| |||| ||||||||| || ||||||||| ||||||||||||| ||| ||||| | |
|
|
| T |
52426980 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggggccgtggttcgaactccagacaccccatttctccacattta-atgatgtgagtt |
52426882 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
52426881 |
ctagccactagactac |
52426866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 16997326 - 16997212
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||||||||||| || | |||||||| |||||||| |||||||||||||||||||||||| |||||||||||||| | ||||||| || |
|
|
| T |
16997326 |
gtgagcttagctcagttggtagagacaatgcatattttatgcaggggccgaggttcgaaccccggacacctcacttctccacattcaattgtgtgagctt |
16997227 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
16997226 |
cagccactacgctac |
16997212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 141 - 242
Target Start/End: Original strand, 23233967 - 23234069
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtgtgaactctagccactaggc |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | || |||||||||||| ||||||| |||||||||||||||| |||||||| |||||||| |||| | |
|
|
| T |
23233967 |
agttggcagggatattgcatattatatgcaggggtcggggttcgaaccccagacaccctacttctccacatttataatgtgtgagctctagccgctagac |
23234066 |
T |
 |
| Q |
240 |
tac |
242 |
Q |
| |
|
||| |
|
|
| T |
23234067 |
tac |
23234069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 18512648 - 18512527
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
18512648 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
18512549 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| ||||||||| |||| |
|
|
| T |
18512548 |
tgagctccagccactagactac |
18512527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 28564402 - 28564297
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| | | |||||||||| ||||||||||||||||||||| ||| | ||||||| |||||||||||| |
|
|
| T |
28564402 |
ctcagttagtagggatattgcagattatatgcaggggttggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccacta |
28564303 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
28564302 |
ggctac |
28564297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 34580860 - 34580771
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
34580860 |
tatccccgtgagttcagctcagttggtagggatattgtatattatatgcaggagctggggttcgaaccccggacactttacttctccaca |
34580771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 238
Target Start/End: Original strand, 42054330 - 42054446
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccctggacattccacttctccacaatttaactgtg |
42054429 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| ||||| |||||||| |
|
|
| T |
42054430 |
tgagctcta-ccactagg |
42054446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 50118968 - 50119089
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
||||| || ||||||| |||| |||||||||| | | |||||| |||||||| | || ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50118968 |
tatccatgcgagtttaactcacttggtagggacaatccatattttatgcaggggtcggagttcgaaccccggacaccccacttctccacatttaattgtg |
50119067 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||| |||||| |
|
|
| T |
50119068 |
tgagctctagccactgggctac |
50119089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 8741471 - 8741591
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtgt |
221 |
Q |
| |
|
|||| ||||| |||| |||||||||||||| ||| |||| | |||||||| || | |||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
8741471 |
tccccgtgagcttagttcagttggtagggacattacataatttatgcaggggcaggggttcgaacccctgacaccccacttctccacatttataatgtgt |
8741570 |
T |
 |
| Q |
222 |
gaactctagccactaggctac |
242 |
Q |
| |
|
|| ||| | |||||||||||| |
|
|
| T |
8741571 |
gagctccaaccactaggctac |
8741591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 128 - 239
Target Start/End: Original strand, 15775742 - 15775854
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| | |||||| |||| ||| | ||||||| || |
|
|
| T |
15775742 |
gtgagcttaactcaattggtagggatattgcatattatatgcaggagccggagttcgaaccccagacactcaacttctacacaattaaattgtgtgagct |
15775841 |
T |
 |
| Q |
227 |
ctagccactaggc |
239 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15775842 |
ctagccactaggc |
15775854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 19063394 - 19063318
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
19063394 |
ttagctcagttagtagagatattgcatattatatgcaggggccggggttcgtaccccggacaccccacttctccaca |
19063318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 40520827 - 40520915
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| | || | |||||||||||| ||||| |||| |||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcatgggctggggttcgaaccccagacactccacctctccaca |
40520915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 139 - 239
Target Start/End: Complemental strand, 45416234 - 45416134
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||| ||| | |||||||| | |||||||| |||| |||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
45416234 |
tcagttggcaggaacattgcataatttatgcaggggccggggttcgaatcccggacaccccacttctccacatttaattgtgtgaactctaaccactagg |
45416135 |
T |
 |
| Q |
239 |
c |
239 |
Q |
| |
|
| |
|
|
| T |
45416134 |
c |
45416134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 241
Target Start/End: Complemental strand, 50824471 - 50824363
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||| || |||| ||| | ||||||| || ||||| |
|
|
| T |
50824471 |
ttagttcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccactccttcacaattaaattgtgtgagctatagcc |
50824372 |
T |
 |
| Q |
233 |
actaggcta |
241 |
Q |
| |
|
|||| |||| |
|
|
| T |
50824371 |
actaagcta |
50824363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 10851827 - 10851942
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| |||||| |||||||| |||||||||||||| | || |||||||||||| || || |||||||||||| ||||| ||| |||||| |
|
|
| T |
10851827 |
gtgagcttagctcaattggtaaggatattgtatattatatgcaggggacggggttcgaaccccagaaactccacttctccacaatttaattgtatgaact |
10851926 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10851927 |
ctagccactaggctac |
10851942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 41709990 - 41709875
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||| |||||||||||||||||| | ||||||||||| | | ||||||||||||| ||||| |||||||||| || ||| | ||||||| || |
|
|
| T |
41709990 |
gtgagcttagcttagttggtagggatattgcgtgttatatgcaggggtcaaggttcgaaccccagacactccacttctccgcaattaaattgtgtgagct |
41709891 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41709890 |
ctagccactaggctac |
41709875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 27818573 - 27818686
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| || | |||| |||| |||| || |||| |||||||||||||| ||| | ||||||| ||| |
|
|
| T |
27818573 |
tgagcttagctcagttggtagggatattgcatattatattcatgggccggggtttgaactccagaca-cccacttctccacaattaaattgtgtgagctc |
27818671 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27818672 |
tagccactaggctac |
27818686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 36726564 - 36726674
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
|||||||||||||||||| |||| |||||| |||||||||||||||||| ||||||||| | |||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
36726564 |
gtgagtttagctcagttgataggaatattgtatattatatgcaggagccaaggttcgaatctcggatactccacttctccacaattaaattgtgtgagct |
36726663 |
T |
 |
| Q |
227 |
ctagccactag |
237 |
Q |
| |
|
||| ||||||| |
|
|
| T |
36726664 |
ctaaccactag |
36726674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 47088803 - 47088923
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta---t |
215 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| | || ||||||||||| || | |||||||||||||||||| ||||||||| ||| ||| | |
|
|
| T |
47088803 |
tttatccccgtgagtttagttcagttggtagggatatcgtattttatatgcaggggctggggttcgaaccccggacactccacttctcgacaattaaatt |
47088902 |
T |
 |
| Q |
216 |
atgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
47088903 |
ttgtgtgagctctagccacta |
47088923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 47643059 - 47642934
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatat--tatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata- |
216 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||| | ||||||||| |||| ||||||||||||| |||| ||||||||||||| ||| | |
|
|
| T |
47643059 |
ttatccctgttaacttagctcagttggtagggatattgcattttatatatgcagaggccggggttcgaaccccgaacactccacttctccacaattaaat |
47642960 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||||| ||||| |
|
|
| T |
47642959 |
tgtgtgagctctagccactatgctac |
47642934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 12650445 - 12650336
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||| | | |||||||| |||||||||||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
12650445 |
ttagctcagttggtaaggatattgcatgttatatgcagaggtcagagttcgaactccggacaccccacttctccacaattaaattgtgtgagctctagcc |
12650346 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
12650345 |
actaggctac |
12650336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 27642787 - 27642679
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| || | |||||||||| |||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
27642787 |
ttagctcagttggtagggatattgcattttatatgcagg-gctggagttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagcc |
27642689 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
27642688 |
actagactac |
27642679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 128 - 237
Target Start/End: Complemental strand, 43021689 - 43021580
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||| |||||||||||| | |||||||| |||||||| | || |||||||||| ||||||||||||||||||||||||| |||||| || |
|
|
| T |
43021689 |
gtgagcttagcttagttggtagggacaatgcatattttatgcaggggtcggggttcgaacctcggacaccccacttctccacatttaatcgtgtgagctg |
43021590 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
43021589 |
tagccactag |
43021580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 120 - 201
Target Start/End: Complemental strand, 46021954 - 46021873
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
46021954 |
ttatccccgtgagcgtagctcagtaagtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac |
46021873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 48897190 - 48897069
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||| |||||||| ||||||||||||||||||||| ||| ||||||||| |||||||| ||||||||||| ||||| |||| |
|
|
| T |
48897190 |
atccccgtgagcttaactcatttggtaggaatattgcatattatatgcaggggccagggttcgaacaccggacactccacttctccataatttaattgtg |
48897091 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
48897090 |
tgagctctaaccactaggctac |
48897069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 122 - 237
Target Start/End: Complemental strand, 4553619 - 4553503
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||||||| ||||||||||||||||||||| || |||||||||| | |||||||| |||||||||||| ||| | |||| |
|
|
| T |
4553619 |
atccccgtgagcttaactcagttggtagaaatattgcatattatatgcaggggctgaggttcgaatctcggacacctcacttctccacaattaaattgtg |
4553520 |
T |
 |
| Q |
221 |
tgaactctagccactag |
237 |
Q |
| |
|
||| ||||| ||||||| |
|
|
| T |
4553519 |
tgagctctaaccactag |
4553503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 139 - 242
Target Start/End: Original strand, 33033140 - 33033244
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||| |||||||| ||| | |||||||| ||||| ||||||| |
|
|
| T |
33033140 |
tcagttggtagggatattgcatattatatgcagggaccggggttcgaaccctagacaccccatttctccacaattaaaatgtgtgagctctaaccactag |
33033239 |
T |
 |
| Q |
238 |
gctac |
242 |
Q |
| |
|
|||| |
|
|
| T |
33033240 |
actac |
33033244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 235
Target Start/End: Complemental strand, 34656462 - 34656354
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||| | | |||||||||| ||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
34656462 |
gtgagtttagctcagttgatagagatattgcattttatatgcaggggttggggttcgaacctcggacactccacttctccacaattaaattgtgtgagct |
34656363 |
T |
 |
| Q |
227 |
ctagccact |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
34656362 |
ctagccact |
34656354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 142 - 214
Target Start/End: Original strand, 36860615 - 36860687
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36860615 |
gttggttgggatattgcatattatatgcagaggccggggtccgaaccccggacaccccacttctccacattta |
36860687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 139 - 210
Target Start/End: Complemental strand, 30451 - 30380
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| |||||||||||||||| | ||||||||||||| |
|
|
| T |
30451 |
tcagttagtagggatattgcattttatatgcaggagccggggttcgaaccccggacgctccacttctccaca |
30380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 234
Target Start/End: Complemental strand, 3694982 - 3694876
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| |||||||| |||||||| |||||||| |||||||||||| ||||| |||| || || |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatgtaggagccggggttcgaa-tccggacactccacttctccacaatttaattgtgcgagct |
3694884 |
T |
 |
| Q |
227 |
ctagccac |
234 |
Q |
| |
|
|||||||| |
|
|
| T |
3694883 |
ctagccac |
3694876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 223
Target Start/End: Complemental strand, 14760823 - 14760723
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |||||||||||||||||||||||| |||||||||| || |||||||||||| | |||||||| |||| |
|
|
| T |
14760823 |
tatccccgtgagcttagctcagttggtag--atattgcatattatatgcaggagctgaggttcgaatcctagacaccccactttttcacatttaattgtg |
14760726 |
T |
 |
| Q |
221 |
tga |
223 |
Q |
| |
|
||| |
|
|
| T |
14760725 |
tga |
14760723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 15390223 - 15390338
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| ||||||| | | | ||||||||| |||||| |||||||||||| ||||| ||||||| | |
|
|
| T |
15390223 |
gtgagcttaactcagttggtagggatattgcatattagatgcaggggttgggattcgaaccctggacactccacttctccacaatttaattgtgtgagtt |
15390322 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
15390323 |
ctagccactaggctac |
15390338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 16313773 - 16313658
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||| |||||||| |||||||||||||||||||||||||| || |||| ||||||||| ||||||||||||| ||| | |||| || || |
|
|
| T |
16313773 |
gtgagcttaactcaattggtaggaatattgcatattatatgcaggagccggagtacgaatcccggacactccacttctccacaattaaattgtgggagct |
16313674 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
16313673 |
ctagccactagactac |
16313658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 50746706 - 50746829
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||| || | || | |||||||||||||||||||||||||||||| ||| | || |
|
|
| T |
50746706 |
ttatccctgtgaccttagctcagttggtagggatatcacatattatatgtagaggtcgggattcgaaccccggacaccccacttctccacaattaaattg |
50746805 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
|| || ||||| ||||||| |||| |
|
|
| T |
50746806 |
tgcgagctctaaccactagactac |
50746829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 923171 - 923089
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||| || |||||||| ||| |||| ||||||||||||| |
|
|
| T |
923171 |
gtgaatttagcgcagttggtagggatattgcatattatatgcaggaggcggagttcgaactccgcacactccacttctccaca |
923089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 10052544 - 10052454
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagg-gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||||||||| |||||||||||||| || | | || ||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10052544 |
tccctgtgagcttagctcagttggttggagcaaatgtataatatatgcaggggccgaggttcgaaccccggacaccccacttctccacatt |
10052454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 12613180 - 12613266
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||||||| | ||| |||||| ||||| |||| |||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
12613180 |
gtgagtttagctcagttggtatgaataatgcataatatatacaggggccgagaatcgaaccccggacaccccacttctctacattta |
12613266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 17776844 - 17776958
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||| | | |||||||||| |||||| |||||||||||| ||| | |||| || ||| |
|
|
| T |
17776844 |
tgagtttagctcagttggtaggcatattgcattttatatgcaggggtcagggttcgaacctcggacatttcacttctccacaattaaattgtgcgagctc |
17776943 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
17776944 |
tagccactaggctac |
17776958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 27178775 - 27178661
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| |||| |||||| |||||||| |||||||||||||| |||| |||||| | ||||||||||||||||||||||| | |||||||| ||| |
|
|
| T |
27178775 |
gtgagcttaactcaattggtaaggatattgtatattatatgcaggggccggaattcgaatctcggacaccccacttctccacattaaaatgtgtgagctc |
27178676 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| |||||| ||||| |
|
|
| T |
27178675 |
taaccactatgctac |
27178661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 30360415 - 30360497
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||| ||| | || |||||||||||||||||| ||||||||||||| |
|
|
| T |
30360415 |
gtgagtttagcttagttggtagagatattgcattttatatgtaggggtcggggttcgaaccccggacactccacttctccaca |
30360497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 48607823 - 48607701
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||||||| |||||||| |||||||||||||| ||||||| ||| |||||||| |||||||| |||| |||||| | |||| ||| | ||| |
|
|
| T |
48607823 |
tatccccgtgagtttaactcagttgatagggatattgcattttatatgtagggtccgaggtttgaaccccgaacactccactttttcacaattaaattgt |
48607724 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| || ||||||||||||||| |
|
|
| T |
48607723 |
gtgagctttagccactaggctac |
48607701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 133 - 211
Target Start/End: Original strand, 50536972 - 50537050
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacat |
211 |
Q |
| |
|
||||||| | |||||||||||||||||||| ||||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
50536972 |
tttagcttaattggtagggatattgcatataatatgcaggagttggggttcgaacctcggacaccccacttctccacat |
50537050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 195
Target Start/End: Original strand, 3269616 - 3269689
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | ||||||||||| ||||| |
|
|
| T |
3269616 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccctggaca |
3269689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 206
Target Start/End: Complemental strand, 3768047 - 3767962
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||| | | |||||||| |||||||||||||||||| |
|
|
| T |
3768047 |
atccctgtgaatttagctcagttggtagggatattgcatatttatatgcaggggttggggttcgaattccggacaccccacttctc |
3767962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 13152914 - 13153023
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| |||| ||||||||||| ||||||| ||||| || | | | |||| | ||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
13152914 |
gtgagtttaactcaattggtagggatgttgcataatatatacatgggttggagttcaatccccggacacctcacttctccacatttaaatgtgtgaactc |
13153013 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
13153014 |
tagccactag |
13153023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 16182201 - 16182310
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaact |
226 |
Q |
| |
|
||||| |||||| ||||||||| |||||||||||||||||||| | || | ||||||| |||| ||||||||||||||||||||| | ||||||||||| |
|
|
| T |
16182201 |
gtgagcttagctgagttggtagagatattgcatattatatgcatgggctggagttcgaatcccgaacaccccacttctccacatttaaaatgtgtgaact |
16182300 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
| || ||||| |
|
|
| T |
16182301 |
caagtcacta |
16182310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 125 - 206
Target Start/End: Original strand, 17580317 - 17580398
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||| || || ||||||||| |||||||| ||||||||| |
|
|
| T |
17580317 |
cctgtgaacttagctcagttggtagggatattgcatgttatatgcagaagtcggggttcgaactccggacactccacttctc |
17580398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 237
Target Start/End: Complemental strand, 18607876 - 18607768
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||| |||||||||||| |||||||| | |||||||| || | ||||||||||||| |||||||||||||| ||||||| ||||||| || |
|
|
| T |
18607876 |
gtgagcttagctgagttggtagggacattgcataatttatgcaggggctggggttcgaaccccgaacaccccacttctctacatttaattgtgtgagct- |
18607778 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
18607777 |
tagccactag |
18607768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 42458262 - 42458159
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| |||| || | |||||||||| ||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
42458262 |
ttagctcagttggtagg-atattacatattatatacaggggcgg-ggttcgaacctcggacactccacttctccacaatttaattgtgtgaactctagcc |
42458165 |
T |
 |
| Q |
233 |
actagg |
238 |
Q |
| |
|
|||||| |
|
|
| T |
42458164 |
actagg |
42458159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 240
Target Start/End: Complemental strand, 42550076 - 42549963
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| | |||||||||||||||||||| ||||||| ||||||||| |||| | ||| ||||||||||||||| ||| | ||||||| | |
|
|
| T |
42550076 |
gtgagcttagctcaatcggtagggatattgcatattacatgcaggggccgaggttttaacctcagacgccccacttctccacaattaaattgtgtgagtt |
42549977 |
T |
 |
| Q |
227 |
ctagccactaggct |
240 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42549976 |
ctagccactaggct |
42549963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 40211596 - 40211477
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| ||| |||||||||||| ||| |||||||||||||||| || |||||||||||||||||| |||||||||||| ||| | | |
|
|
| T |
40211596 |
tttatccccgtgagcttaactcagttggtag-----ttgtatattatatgcaggagtcggggttcgaaccccggacacttcacttctccacaattaaatt |
40211502 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| || ||||||||||||||| |
|
|
| T |
40211501 |
gtgtgagctatagccactaggctac |
40211477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 43668018 - 43667942
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| ||| ||||||||||||| ||| ||||||||||||| |
|
|
| T |
43668018 |
ttagctcagttcgtagagatattgcatattatatgcaggaaccggggttcgaaccccgaacattccacttctccaca |
43667942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 3560448 - 3560333
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||| |||||||||||||| || | ||||||||||| || || |||||||||||| ||||| ||||||| || |
|
|
| T |
3560448 |
gtgagcttaactcagttggtagggatattatatattatatgcaggggctggagttcgaaccccagatactccacttctccacaatttaattgtgtgagct |
3560349 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
3560348 |
ctagccactagactac |
3560333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 8415732 - 8415846
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||| | || ||||| |||||| ||||||||| |||||||| || || ||||||| || |
|
|
| T |
8415732 |
gtgagcttagctcagttcgtagggatattgcatattatatgcaggggtcggggttcaaacccc-gacaccccatttctccacaatataattgtgtgagct |
8415830 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
8415831 |
ataaccactaggctac |
8415846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 132 - 242
Target Start/End: Complemental strand, 10248492 - 10248382
Alignment:
| Q |
132 |
gtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctag |
230 |
Q |
| |
|
||||| |||||||||||| ||||||| |||||||||||||| || |||| ||||||||||||| |||||||||||| | ||| |||||||||||||| |
|
|
| T |
10248492 |
gtttaactcagttggtagagatattgtatattatatgcagg-ctcggggtttgaaccccggacactccacttctccacaaattaactgtgtgaactctag |
10248394 |
T |
 |
| Q |
231 |
ccactaggctac |
242 |
Q |
| |
|
||||||| |||| |
|
|
| T |
10248393 |
ccactagactac |
10248382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 237
Target Start/End: Complemental strand, 21401485 - 21401390
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| |||||||||| || ||||| |||||||||||| ||| | ||||||| || |||||||||| |
|
|
| T |
21401485 |
ttggtaggaatattgcatattatatgcaggggccgcggttcgaacctcgaacaccacacttctccacaattaaattgtgtgagctttagccactag |
21401390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 25036329 - 25036234
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| | |||||||| |||| | ||||||||||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
25036329 |
gtgagtttagctcagttggcaggaacattgcataatttatgcaggggccgggattcgaaccccgaacaccccatttctccacatttaattgtgtga |
25036234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 25041541 - 25041446
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| | |||||||| |||| | ||||||||||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
25041541 |
gtgagtttagctcagttggcaggaacattgcataatttatgcaggggccgggattcgaaccccgaacaccccatttctccacatttaattgtgtga |
25041446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 241
Target Start/End: Original strand, 26824200 - 26824307
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||| |||||||| ||| | |||||||| |||||||| |||||||||||||| |||| |||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
26824200 |
ttaggtcagttggcaggaacattgcataacttatgcaggggccgaggttcgaactccgggcaccatacttctccacatttaattgtgtgagctctagcca |
26824299 |
T |
 |
| Q |
234 |
ctaggcta |
241 |
Q |
| |
|
|||||||| |
|
|
| T |
26824300 |
ctaggcta |
26824307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 143 - 242
Target Start/End: Complemental strand, 26909922 - 26909823
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| |||||||| | ||||||| || | ||||||||||| |||||||||||||||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
26909922 |
ttggcagggacattgcataatttatgcagaggcgggggttcgaaccctggacaccccacttctccacatttaaatgtgtgagcttcagccactaggctac |
26909823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 30246096 - 30245977
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| |||||||| |||||||||| |||||||| | ||||||| | || | ||||||||||| | |||||||||||||||||||| ||| || |
|
|
| T |
30246096 |
tccccgtgagcttagctcatttggtagggacattgcataattgatgcaggggtcgggattcgaaccccgaataccccacttctccacatttaattgtatg |
30245997 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||||||||||| |||| |
|
|
| T |
30245996 |
agctctagccactagactac |
30245977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 35068717 - 35068800
Alignment:
| Q |
155 |
ttgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||| |||||||| || |||||| |||| |
|
|
| T |
35068717 |
ttgcatattatatggaggggccggggttcgaaccccggacaccccacttctccacattagaatgtgtgagctttagccattagg |
35068800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 15165957 - 15165843
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactc |
227 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| |||||| |||| | | ||||||||| |||||||||||||||||||||||| | || | |||||| |
|
|
| T |
15165957 |
tgagtttaactcagttggtaggaatattgcatgttatatacaggggttgcagttcgaacctcggacaccccacttctccacatttaaaatatctgaacta |
15165858 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
15165857 |
tagccactagactac |
15165843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 138 - 208
Target Start/End: Original strand, 19924444 - 19924514
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| ||| || |||||||||||||||||| ||||||||||| |
|
|
| T |
19924444 |
ctcagttggtagggatatcgcattttatatgcaagagtcggggttcgaaccccggacactccacttctcca |
19924514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 207
Target Start/End: Complemental strand, 23369120 - 23369042
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
|||| ||| |||||||| | ||||||||| |||||||||||||| |||| |||||||||||||||||||||| |||||| |
|
|
| T |
23369120 |
tgagcttaactcagttgatcgggatattgtatattatatgcaggggccgcggttcgaaccccggacaccccaattctcc |
23369042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 231
Target Start/End: Original strand, 27233988 - 27234094
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaa |
224 |
Q |
| |
|
||||||| |||| ||| |||||| | ||||||||||||||||||||| |||| |||||||| |||| |||| ||||||||||||| ||| | ||||||| |
|
|
| T |
27233988 |
ctgtgagcttagttcaattggtatgaatattgcatattatatgcaggggccggggttcgaatcccgaacactccacttctccacaattaaattgtgtgag |
27234087 |
T |
 |
| Q |
225 |
ctctagc |
231 |
Q |
| |
|
||||||| |
|
|
| T |
27234088 |
ctctagc |
27234094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 121 - 210
Target Start/End: Original strand, 14519316 - 14519405
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||||||| |||||||| |||||||||| |||||||||| |||||| || ||||||| |||| ||||| | ||||||||||| |
|
|
| T |
14519316 |
tatcccggtgagtttatctcagttgatagggatattccatattatattcaggagtcggggttcgagccccagacactcaacttctccaca |
14519405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 17350055 - 17350136
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||| |||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
17350055 |
tccccgtgagtatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
17350136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 221
Target Start/End: Original strand, 25034907 - 25034999
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| ||||||| ||| ||| ||||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
25034907 |
gtgagcttagctcagttggtaggaatattgcattttatatgtaggggccagagttcgaaccccagaca-cccacttctccatatttatatgtgt |
25034999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 28344885 - 28344993
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| ||| | || || |||||||||||||| |||||||||||||| ||| | | ||||| ||||||| |
|
|
| T |
28344885 |
ttagatcagttggtagggatattgcat-ttatatgtaggggtcggggatcgaaccccggacatcccacttctccacaattaaattatgtgagttctagcc |
28344983 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
28344984 |
actaggctac |
28344993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 206
Target Start/End: Original strand, 31818598 - 31818675
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||| |||| ||||||| |||| |||||||||||||||||||||||||| |||||||||||| || || ||||||||| |
|
|
| T |
31818598 |
tgagcttagttcagttgctaggaatattgcatattatatgcaggagccggggttcgaaccccagatactccacttctc |
31818675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 138 - 235
Target Start/End: Complemental strand, 34750446 - 34750351
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||| ||||| ||| |||||| ||||||||||||||| |||||||| || ||||| ||||||||||| |
|
|
| T |
34750446 |
ctcaattggtagggatattgcataatttatgcagg-gccgatgtttgaaccctggacaccccacttct-cacatttaaatatgtgagctctagccact |
34750351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 39238722 - 39238791
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39238722 |
tagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccactt |
39238791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 120 - 233
Target Start/End: Complemental strand, 8841317 - 8841201
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggat----attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat |
215 |
Q |
| |
|
||||||| |||| |||||||||||| ||||||| ||||| ||||||||||||| | |||||||||||||||||||| ||| ||||||||| |||| |
|
|
| T |
8841317 |
ttatccccgtgaacttagctcagttgatagggatcgacattgcgtattatatgcaggggtcgaggttcgaaccccggaca-ccctcttctccacgtttaa |
8841219 |
T |
 |
| Q |
216 |
atgtgtgaactctagcca |
233 |
Q |
| |
|
|| ||||| ||||||||| |
|
|
| T |
8841218 |
atatgtgagctctagcca |
8841201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 18101445 - 18101566
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| |||| ||| |||||||||||| |||||| ||||||| ||| ||| ||||||||||||||| ||||| || ||||||||||||||| | | |
|
|
| T |
18101445 |
tttatccccgtgatcttatctcagttggtagagatattacatatta-atgtagggaccgaggttcgaaccc-ggacatcc-acttctccacatttaaaat |
18101541 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
18101542 |
gtgttaactctagccactaggctac |
18101566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 138 - 210
Target Start/End: Original strand, 23393661 - 23393733
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| | |||||||||||||||| |||| ||||||||||||| |
|
|
| T |
23393661 |
ctcagttggtagggatatcacattttatatgcaggggtcgaggttcgaaccccgaacactccacttctccaca |
23393733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 163 - 242
Target Start/End: Complemental strand, 32589521 - 32589441
Alignment:
| Q |
163 |
tatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||||| ||| | ||||||| ||||| |||||||||||| |
|
|
| T |
32589521 |
tatatgcaggagccggggttcgaaccccggtcactccacttctccacaattaaattgtgtgagctctaaccactaggctac |
32589441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 44440585 - 44440693
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||| | || | ||||||||| |||||||||||||||||| ||||| |||||| | |||||||| |
|
|
| T |
44440585 |
ttagctcagttggtggggatattacatgttatatgcaagggcaggggttcgaactccggacaccccacttctctacattataatgtgtaagttctagcca |
44440684 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||| ||||| |
|
|
| T |
44440685 |
ctacgctac |
44440693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 227
Target Start/End: Complemental strand, 49503222 - 49503118
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||||||||| ||||||| |||| ||||| ||| |||| | |||||||| |||| |||||||| |||||||||||| |||| |||||||| ||||||| |
|
|
| T |
49503222 |
tccctgtgagcatagctcaattggcagggacattacataatttatgcaggggccggagttcgaacgccggacaccccagttcttcacatttaaatgtgtg |
49503123 |
T |
 |
| Q |
223 |
aactc |
227 |
Q |
| |
|
||||| |
|
|
| T |
49503122 |
aactc |
49503118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 129 - 236
Target Start/End: Original strand, 51933510 - 51933618
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||| || ||||||||| || |||| ||| ||||||||| ||| | ||||||| || |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatgcaggaatcggggttcgaactccagacattccatttctccacaattaaattgtgtgaggtc |
51933609 |
T |
 |
| Q |
228 |
tagccacta |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
51933610 |
tagccacta |
51933618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 3742333 - 3742270
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| || | |||||||||||| |
|
|
| T |
3742333 |
ggttcgaaccccggacaccccacttctccacatttacatgtgtgagttccaaccactaggctac |
3742270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 4281392 - 4281500
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt--gaactctagc |
231 |
Q |
| |
|
||||||||| |||||||||||||| | ||||||||||| | | |||| ||||||||||||||| ||||||||||||||| |||||| || ||||||| |
|
|
| T |
4281392 |
ttagctcagctggtagggatattgtaaattatatgcagagggcatggtt-gaaccccggacaccc-acttctccacatttaaatgtgtgagagctctagc |
4281489 |
T |
 |
| Q |
232 |
cactaggctac |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
4281490 |
cactaggctac |
4281500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 6213416 - 6213539
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||| |||||| |||||||| ||||||||||||||||||||||||| |||| | | |||| ||| |||||| ||||||||||| |||| ||| | || |
|
|
| T |
6213416 |
ttatcactgtgaacttagctcaattggtagggatattgcatattatatacaggggtcagggtttgaatcccggataccccacttcttcacaattaaattg |
6213515 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||| |||| |
|
|
| T |
6213516 |
tgtgagttctagccactagactac |
6213539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 132 - 242
Target Start/End: Original strand, 10632701 - 10632812
Alignment:
| Q |
132 |
gtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca-ccccacttctccacatttatatgtgtgaactctag |
230 |
Q |
| |
|
|||||||||| |||| | || |||||||| | |||||||| | || ||||||||||||||||| ||||||||||||||||||| |||||||| || | |
|
|
| T |
10632701 |
gtttagctcaattggcggagacattgcataatttatgcaggggtcggggttcgaaccccggacacccccacttctccacatttaaatgtgtgagcttccg |
10632800 |
T |
 |
| Q |
231 |
ccactaggctac |
242 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10632801 |
ccactaggctac |
10632812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 197
Target Start/End: Original strand, 24253781 - 24253844
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| | | ||||||||||||| |||||| |
|
|
| T |
24253781 |
ttagctcatttggtagggatattgcatattatatgcaggggtcaaggttcgaaccccagacacc |
24253844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 139 - 206
Target Start/End: Original strand, 27650711 - 27650778
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
27650711 |
tcagttggtagggatattgcatattatatgcagggataaaggttcgaaccccggacacctcacttctc |
27650778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 41926975 - 41927093
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||||||| |||||||| |||| | |||||||| | ||||| || || ||| |||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
41926975 |
tccccgtgagtttaactcagttgatagg-acattgcataatttatgctggggctgagattcgaatcccggacaccttacttctccacatttaattgtgtg |
41927073 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||| |||||||||||| |
|
|
| T |
41927074 |
agctctaaccactaggctac |
41927093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 188 - 242
Target Start/End: Original strand, 7491824 - 7491878
Alignment:
| Q |
188 |
cccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
7491824 |
cccggacaccccacttctccacatttaattgtgtgagctctagccactaggctac |
7491878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 141 - 223
Target Start/End: Complemental strand, 24910532 - 24910450
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||||||||||||||| | |||||||| | | |||||||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
24910532 |
agttggtagggatattgcataatttatgcaggggtcagggttcgaaccccggacactccacttctccatatttaattgtgtga |
24910450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 25580691 - 25580773
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| |||||||||||| ||||||||||||||||||| |||| | ||||||||||| |||||| |||||||||||| |
|
|
| T |
25580691 |
gtgagcttaactcagttggtagagatattgcatattatatgccggagtcagggttcgaaccctggacacttcacttctccaca |
25580773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 26820722 - 26820616
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagc |
231 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||| | || | || |||||||||||||||| ||||||||| ||| | |||| || ||||||| |
|
|
| T |
26820722 |
ttagctcagttggtagggatattgaatatttatatgcaggggtcgggatttaaaccccggacaccccatttctccacaattaaattgtgcgagctctagc |
26820623 |
T |
 |
| Q |
232 |
cactagg |
238 |
Q |
| |
|
||||||| |
|
|
| T |
26820622 |
cactagg |
26820616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 120 - 202
Target Start/End: Complemental strand, 31762071 - 31761989
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
||||||| ||||| ||||||||||||| || ||||||||||||||||| ||| | |||||||||||| |||||||| ||||| |
|
|
| T |
31762071 |
ttatcccagtgagcttagctcagttggcagtgatattgcatattatatttaggggtcgaggttcgaacaccggacactccact |
31761989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 132 - 202
Target Start/End: Original strand, 40634208 - 40634278
Alignment:
| Q |
132 |
gtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccact |
202 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| | | |||||||||||||| ||| ||||| |
|
|
| T |
40634208 |
gtttaactcagttggtagggatattgcatattatatgcaggggatggggttcgaaccccgggcactccact |
40634278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 44019279 - 44019361
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||||||| | | || | |||||| ||||||||| ||||||||||||| |
|
|
| T |
44019279 |
gtgagcttagctcagttgatagggatattgcattttatatgcaagggtcgggattcgaatcccggacactccacttctccaca |
44019361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 179 - 241
Target Start/End: Original strand, 48368516 - 48368577
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||||||||| ||||||||||| |
|
|
| T |
48368516 |
ggttcgaacctcggacaccccacttctccacattaat-tgtgtgaactctaaccactaggcta |
48368577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 146 - 238
Target Start/End: Complemental strand, 1604273 - 1604180
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactagg |
238 |
Q |
| |
|
||||||||||||||||||||||| ||| | || ||||||||||| |||||| || |||||||||||| | |||||||| ||||| |||||||| |
|
|
| T |
1604273 |
gtagggatattgcatattatatgtaggggtcggggttcgaacccttgacaccacaattctccacatttaaaatgtgtgagctctaaccactagg |
1604180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 12374586 - 12374466
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| |||||||||| || |||| || |||||||||||||||||||| | | || |||||||| |||||||||||||||||| |||| ||| | |||| |
|
|
| T |
12374586 |
atccccgtgagtttagttcgattggcagagatattgcatattatatgcaagggtcggggttcgaa-cccggacaccccacttcttcacaattaaattgtg |
12374488 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||| ||||| ||||| |
|
|
| T |
12374487 |
tgagctctagtcactatgctac |
12374466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 185 - 242
Target Start/End: Original strand, 17487586 - 17487643
Alignment:
| Q |
185 |
aaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
17487586 |
aaccccggacaccccacttctccatttttatatgtgtgagctccagccactaggctac |
17487643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 131 - 203
Target Start/End: Complemental strand, 34940509 - 34940437
Alignment:
| Q |
131 |
agtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| |||||| |||||| ||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
34940509 |
agtttagctcacttggtaagggataatgcatattatatgcaggggtc-aggttcgaaccccggacaccccactt |
34940437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 125 - 242
Target Start/End: Original strand, 41620379 - 41620496
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaa |
224 |
Q |
| |
|
|||||||| ||| |||||||| |||| | |||| ||| | |||||||| ||| ||||||||||||| | | | ||||||||||||||| ||||||| |
|
|
| T |
41620379 |
cctgtgagcttaactcagttgataggaacattgtataatttatgcaggggcccgggttcgaaccccgatctctctacttctccacatttaattgtgtgag |
41620478 |
T |
 |
| Q |
225 |
ctctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41620479 |
ctctagccactaggctac |
41620496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 228
Target Start/End: Original strand, 621580 - 621680
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||| |||||||| | || |||||||||||| ||| | || ||||||| ||||| |||||||| ||| |
|
|
| T |
621580 |
gtgaatttaactcagttgatagggatattgcatattttatgcaggggtcggggttcgaaccccaaacatcacatttctccatatttaaatgtgtgagctc |
621679 |
T |
 |
| Q |
228 |
t |
228 |
Q |
| |
|
| |
|
|
| T |
621680 |
t |
621680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 129 - 236
Target Start/End: Original strand, 10478145 - 10478252
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||| || |||||||||||| | | |||||||||||| |||| |||||||| |||| ||| | ||||||| ||| |
|
|
| T |
10478145 |
tgagtttagctcggttggtagggatattgtattttatatgcaggatcag-ggttcgaaccccagacattccacttctgcacaattaaattgtgtgagctc |
10478243 |
T |
 |
| Q |
228 |
tagccacta |
236 |
Q |
| |
|
|| |||||| |
|
|
| T |
10478244 |
taaccacta |
10478252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 223
Target Start/End: Original strand, 11860040 - 11860140
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||||||||| || | |||||||| | ||| ||| | || |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11860040 |
tccccgtgagcttagctcagttggcagaaacattgcataatttatataggggtcggggttcgaaccccggacaccccacttctccacatttaattgtgtg |
11860139 |
T |
 |
| Q |
223 |
a |
223 |
Q |
| |
|
| |
|
|
| T |
11860140 |
a |
11860140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 14349653 - 14349729
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||| || |||||||||||||||||| || ||||||||| |
|
|
| T |
14349653 |
ttagctcagttggtagagatattgcatattatatgtagggatcggggttcgaaccccggacactacatttctccaca |
14349729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 15368812 - 15368917
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| ||||||||||||||||||||||||| | || |||||| | ||||| |||||||| |
|
|
| T |
15368812 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattca-ttttataag-gtgaattctagcca |
15368908 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
15368909 |
ctaggctac |
15368917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 146 - 242
Target Start/End: Complemental strand, 28503578 - 28503482
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||| ||||||| ||||||||||| |||||| |||||| | |||||||| || || ||||||| |||| |
|
|
| T |
28503578 |
gtagagatattgcatattatatgtagggaccgatgttcgaatcccggacaccctacttcttcacattaaaatgtgtgagctttaaccactagactac |
28503482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 31762205 - 31762129
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||| | |||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
31762205 |
ttagctcagttggtaagaatattgcatattatattcagaggtcgaggttcgaacaccggacactccactcctccaca |
31762129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 142 - 210
Target Start/End: Original strand, 33130764 - 33130832
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | || ||||||||||||| |||| ||| ||||||||| |
|
|
| T |
33130764 |
gttggtagggttattgcatattatatgcaggggtcggggttcgaaccccgaacacgccatttctccaca |
33130832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 33843256 - 33843148
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||| ||| ||||||||||| | ||||||| | || ||||||||||||| ||||||||||||| ||| |||| ||||||| ||| ||||| |
|
|
| T |
33843256 |
ttagctcagttgatagagatattgcataatttatgcagaggtcggggttcgaaccccgaacaccccacttcttcacgtttaattgtgtgagctccagcca |
33843157 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||| |||| |
|
|
| T |
33843156 |
atagactac |
33843148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 33950723 - 33950831
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||| ||| ||||||||||| | ||||||| | || ||||||||||||| ||||||||||||| ||| |||| ||||||| ||| ||||| |
|
|
| T |
33950723 |
ttagctcagttgatagagatattgcataatttatgcagaggtcggggttcgaaccccgaacaccccacttcttcacgtttaattgtgtgagctccagcca |
33950822 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||| |||| |
|
|
| T |
33950823 |
atagactac |
33950831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 35283497 - 35283613
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| |||| ||| ||||||||||| |||||| |||||||||||||| |||| ||||||||||| | |||| |||||||||||| ||||| ||| |
|
|
| T |
35283497 |
tatccccgtgaacttaactcagttggtaaagatattacatattatatgcagaggccggggttcgaaccctgaacactccacttctccacaatttaattgt |
35283596 |
T |
 |
| Q |
220 |
gtgaactctagccacta |
236 |
Q |
| |
|
|||| ||||| |||||| |
|
|
| T |
35283597 |
gtgagctctaaccacta |
35283613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 42469412 - 42469500
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||||| ||||||||||||| ||||||| ||||||||| |||| | ||| |||||||| |||||||| ||||||| |||| |
|
|
| T |
42469412 |
atccccgtgagtttcgctcagttggtagagatattgtatattatatacaggggatgagattcgaacctcggacacctcacttcttcaca |
42469500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 44546018 - 44546106
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||| ||| | |||||||| | ||||||||| | |||||||||||||||||||| |
|
|
| T |
44546018 |
atccctgtgagtttagctcaattggtagggacattgtataatttatgcagggatcacggttcgaactctggacaccccacttctccaca |
44546106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 45271775 - 45271831
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
45271775 |
ttagttcagttggtagggatattgcatattatatgcaggggtcgaggttcaaacccc |
45271831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 50103915 - 50103979
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
50103915 |
ggttcgaaccctggacacctcacttctccacatttaaaatgtgtcaactctagccactaggctac |
50103979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 189
Target Start/End: Original strand, 1836500 - 1836567
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccc |
189 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||||||||||||||| | | || ||||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcaggggtcaagattcgaaccc |
1836567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 214
Target Start/End: Original strand, 13763763 - 13763850
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| || |||||||||||||||| | ||||| ||||||||||| || | ||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
13763763 |
gtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctggggttcgaaccccggataccccacttctctacattta |
13763850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 18911848 - 18911963
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | || || ||||||||||| | | |||||||||||||||||||||||| |||||||||| | ||||| |
|
|
| T |
18911848 |
tccccgtgagctttgctcagttggtagggacaaatgaattttatatgcaggggtcagggttcgaaccccggacaccccactcctccacatttaaaatgtg |
18911947 |
T |
 |
| Q |
221 |
tgaactctagccacta |
236 |
Q |
| |
|
||| ||| |||||||| |
|
|
| T |
18911948 |
tgagctccagccacta |
18911963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 19424066 - 19424121
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| ||||||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
19424066 |
agggataatgcatattatatgcaggggtcggggttcgaaccccggacaccccactt |
19424121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 131 - 242
Target Start/End: Complemental strand, 22592651 - 22592533
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatat------tatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtga |
223 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||| ||| |||| |||| |||||||||||||||||||| |||| |||||||||| |
|
|
| T |
22592651 |
agtttagctcagttggtagggatgttgcatataaatattatatgcagagaccggggtttgaactccggacaccccacttctccatatttaatatgtgtga |
22592552 |
T |
 |
| Q |
224 |
actctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||| |||| |
|
|
| T |
22592551 |
gttctaaccactagactac |
22592533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 47402737 - 47402686
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47402737 |
tatccccgtgagcttagctcagctggtagggatattgcatattatatgcagg |
47402686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 2997724 - 2997638
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| || |||||||| ||||||| |||||||| | |||||||| || | |||||||||||| |||||||||| |||||| ||||| |
|
|
| T |
2997724 |
gtgagctttgctcagttagtagggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccacatctccatattta |
2997638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 14396443 - 14396557
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||||||| ||||||||| ||| ||||||||||| | || ||||||||||||| |||| ||| ||||| ||| ||| | | ||||| ||| |
|
|
| T |
14396443 |
tgagcttagctcagttgatagggatatcacattttatatgcaggggtcggggttcgaaccccgaacactccatttctctacaattaaattatgtgagctc |
14396542 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
14396543 |
tggccactaggctac |
14396557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 18893330 - 18893240
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatatt-atatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| || || |||||||||||||||||||||| ||| || |||||||| |||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
18893330 |
tatccccgtcagcttagctcagttggtagggatatcacatttttatatgcagaggccggggttcgaatcccggacactccacttctccaca |
18893240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 20030081 - 20030163
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| ||||||||||||| ||||||||| ||||||||||| | || ||||||||| ||||||| ||| ||||||||| |
|
|
| T |
20030081 |
gtgagcttatctcagttggtaggaatattgcattttatatgcaggggtcggggttcgaacatcggacactccaattctccaca |
20030163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 122 - 172
Target Start/End: Original strand, 34271841 - 34271891
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
34271841 |
atccccgtgagtttagctcagctggtagggatattacatattatatgcagg |
34271891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 39940369 - 39940287
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||| ||||| |||||||||||| | || |||||| ||| ||| | |||||||||| ||| ||||||||||||||||| |
|
|
| T |
39940369 |
gtgagtttaactcagatggtagggatatcgtatgttatatacagaagcagtggttcgaacctcggtcaccccacttctccaca |
39940287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 136 - 242
Target Start/End: Original strand, 51137795 - 51137901
Alignment:
| Q |
136 |
agctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||| |||||||||| |||| ||| | |||||||| |||| |||||||| | ||||| |||||||||||||||||| ||||| || ||| | ||||| |
|
|
| T |
51137795 |
agctcaattggtagggacattgtataatttatgcaggggccggagttcgaactctggacatcccacttctccacatttaaatgtgcgagctccaaccact |
51137894 |
T |
 |
| Q |
236 |
aggctac |
242 |
Q |
| |
|
| ||||| |
|
|
| T |
51137895 |
aagctac |
51137901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 2052771 - 2052702
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| || ||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
2052771 |
tagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccactt |
2052702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 233
Target Start/End: Complemental strand, 12182081 - 12181976
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| || |||||||||||||| ||||||||| || ||||||| | ||||||||||| | | ||||| | ||||||||||||||| ||||||| ||| |
|
|
| T |
12182081 |
gtgagctttgctcagttggtaggaatattgcatgttgtatgcagaggtcgaggttcgaatctcagacactcaacttctccacatttaattgtgtgagctc |
12181982 |
T |
 |
| Q |
228 |
tagcca |
233 |
Q |
| |
|
||||| |
|
|
| T |
12181981 |
cagcca |
12181976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 25819191 - 25819260
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||| |||||||| ||||||||||||||| ||||||||| |
|
|
| T |
25819191 |
tagctcagttggcagggacaatgcattattatatgtaggagccggggttcgaaccccggataccccactt |
25819260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 27784106 - 27784041
Alignment:
| Q |
145 |
ggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||| |||||||||||||||| || | | ||||||||| |||||| ||||||||||||| |
|
|
| T |
27784106 |
ggtagggatatcgcatattatatgcaggggctgtgattcgaaccctggacactccacttctccaca |
27784041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 29491476 - 29491545
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
29491476 |
tagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccactt |
29491545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 241
Target Start/End: Original strand, 29527126 - 29527230
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccact |
235 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| | ||||||| ||| ||| ||||| |||||||||| | |||||||| ||||||||||| |
|
|
| T |
29527126 |
gctcagttggtatggatattgtatattatatgcaggagttggagttcgaa-cccaaacattccactcctccacatttaaaatgtgtgagctctagccact |
29527224 |
T |
 |
| Q |
236 |
aggcta |
241 |
Q |
| |
|
|||||| |
|
|
| T |
29527225 |
aggcta |
29527230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 33200036 - 33200157
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtg |
220 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| | |||||| |||||| ||| | || ||||| || ||||||||| ||||||||||||||| ||||||| |
|
|
| T |
33200036 |
tccccgtgagcttagctcagttggtagggacaaatgcataatatatgtaggggtcggggttcaaatcccggacactccacttctccacattaaatatgtg |
33200135 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || |||||||| ||||| |
|
|
| T |
33200136 |
tgagcttcagccactatgctac |
33200157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 40678829 - 40678898
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
40678829 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccactt |
40678898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 203
Target Start/End: Original strand, 42367725 - 42367790
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| |||| |||||||| |||||||| ||||||| |
|
|
| T |
42367725 |
ctcagttggcagggacgttgcatattatatgcaggggccggggttcgaatcccggacaacccactt |
42367790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 50566675 - 50566566
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcag-gagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaact |
226 |
Q |
| |
|
||||||||| |||||||||||| ||| || |||||||||||| | | || |||||||||||| | | ||||||||||||||||||||||||||| | |
|
|
| T |
50566675 |
gtgagtttaactcagttggtagaaatactgtatattatatgcaaagcgtcggggttcgaaccccaggtatcccacttctccacatttatatgtgtgagat |
50566576 |
T |
 |
| Q |
227 |
ctagccacta |
236 |
Q |
| |
|
||| |||||| |
|
|
| T |
50566575 |
ctaaccacta |
50566566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 214
Target Start/End: Complemental strand, 4865879 - 4865803
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||| |||||||| |||||| ||| | || |||||||||||| |||| |||||||| |||||||| |
|
|
| T |
4865879 |
ctcagttggtagggacattgcataatatatgtaggggtcggagttcgaaccccgaacactccacttcttcacattta |
4865803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 139 - 207
Target Start/End: Original strand, 5862986 - 5863054
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||| || | ||| ||||| |||| ||||||||| ||||||||| |
|
|
| T |
5862986 |
tcagttggtagggatattacatattatatccaagggccaaggtttgaactccggacacctcacttctcc |
5863054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 32970860 - 32970753
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| | || | || | ||||| | || ||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
32970860 |
tagctcagttgatagggatattgcattttatatgcaggggtcgggatttg-accccaaaaactccacttctccacaattaaattgtgtgagctctagcca |
32970762 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
32970761 |
ctaggctac |
32970753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 237
Target Start/End: Complemental strand, 34557353 - 34557281
Alignment:
| Q |
165 |
tatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||| | || |||||||| | |||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
34557353 |
tatgcaggggtcggggttcgaatcttggacaccctacttctccacatttaaatgtgtgagctctagccactag |
34557281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 172
Target Start/End: Complemental strand, 42299580 - 42299536
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42299580 |
gtgagcttagttcagttggtagggatattgcatattatatgcagg |
42299536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 172
Target Start/End: Original strand, 46225390 - 46225434
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatgcagg |
46225434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 229
Target Start/End: Complemental strand, 49425035 - 49424943
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactcta |
229 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| | | | |||||||| ||||||| ||||||||||| | ||| | ||||||||||||| |
|
|
| T |
49425035 |
ctcaattggtagggatattgcatattatatgcagaaactggagttcgaacatcggacactccacttctccataattaaattgtgtgaactcta |
49424943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 203
Target Start/End: Original strand, 11067475 - 11067514
Alignment:
| Q |
164 |
atatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11067475 |
atatgcaggagccgaggttcgaaccgcggacaccccactt |
11067514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 13870180 - 13870101
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| |||||||||||| ||||| | ||||| |||||||||||| |||| |||| ||| |||||||||||||||| |
|
|
| T |
13870180 |
cctgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggtttgaatcccggacaccccactt |
13870101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 21884607 - 21884650
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
21884607 |
tattatatgcaggggccgaggttcgaaccccagacaccccactt |
21884650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 23464049 - 23464006
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
23464049 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
23464006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 24134719 - 24134644
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
24134719 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccactt |
24134644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 242
Target Start/End: Original strand, 24499783 - 24499842
Alignment:
| Q |
183 |
cgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
24499783 |
cgaaccccggacaccctacttctccacatttaattgtgtgagatttagccactaggctac |
24499842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 27870934 - 27871048
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||| || | ||||||||||||| |||| |||||||||||| | ||||||||| ||||||| ||| ||||||||| ||| | ||||| | || |
|
|
| T |
27870934 |
gtgagtttaacttaattggtagggatatcgcattttatatgcaggaattggagttcgaacctcggacactcca-ttctccacaattaaattgtgtaagct |
27871032 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27871033 |
ctagccactaggctac |
27871048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 171
Target Start/End: Complemental strand, 32556996 - 32556953
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32556996 |
gtgagcttagctcagctggtagggatattgcatattatatgcag |
32556953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 208
Target Start/End: Complemental strand, 35121119 - 35121037
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||||||||| ||||||| | |||| |||||||||||| |||||||||||| |
|
|
| T |
35121119 |
cctgtgagcttagcttagttggtagcgatattgcatattacatgcagggtttggggtttgaaccccggaca-cccacttctcca |
35121037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 142 - 241
Target Start/End: Original strand, 37280719 - 37280817
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||||||||| |||||||| | ||| ||| | || | ||||||| |||| ||||||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
37280719 |
gttggtagggacattgcataatttatataggggtcgggattcgaactccgg-caccccacttctccacatttaattgtgtgagctccagccactaggcta |
37280817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 38852067 - 38851985
Alignment:
| Q |
159 |
atattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||| |||||||||| |||| | ||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
38852067 |
atattttatgcaggagccgatattcgaaccccaaacactc-acttctccacatttaattgtgtgagttctagccactaggctac |
38851985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 203
Target Start/End: Complemental strand, 42946542 - 42946487
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| ||||||||||||||||| || | |||| |||||||||||||||||||| |
|
|
| T |
42946542 |
agggataatgcatattatatgcaggggctggggtttgaaccccggacaccccactt |
42946487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 242
Target Start/End: Original strand, 48643643 - 48643741
Alignment:
| Q |
144 |
tggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| |||||||| |||| || |||||| ||||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
48643643 |
tggtagagatattgcatattatatgcagg-gccggagttcgaacttcggatactccactttaccacaattaaattgtgtgagctctagccactaggctac |
48643741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 242
Target Start/End: Original strand, 49907331 - 49907398
Alignment:
| Q |
176 |
cgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||||||| || | ||||||| |||| | |||||||||||| |||||||||||||| |
|
|
| T |
49907331 |
cgaggttcgaaccccggacatcctatttctccatatttaaaatgtgtgaactccagccactaggctac |
49907398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 135 - 240
Target Start/End: Complemental strand, 3341824 - 3341719
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||| ||||| || |||| |||||||||||| |||| || |||||||||||||||||||||| | ||| || | | ||||| |||||||| |
|
|
| T |
3341824 |
tagctcagttggcagggacat-gcattattatatgcaggggccggggatcgaaccccggacaccccacttattcaccttgaaaaaggtgaattctagcca |
3341726 |
T |
 |
| Q |
234 |
ctaggct |
240 |
Q |
| |
|
||||||| |
|
|
| T |
3341725 |
ctaggct |
3341719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 138 - 208
Target Start/End: Complemental strand, 10699240 - 10699170
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||||| ||| |||||| ||||||||||| ||| |||| |||||||| |||||||||| ||||||||| |
|
|
| T |
10699240 |
ctcagttgttagagatattacatattatatgtaggggccggggttcgaatcccggacacctaacttctcca |
10699170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 10842124 - 10842010
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||| ||| | | ||| |||||||| | |||| ||| || || ||||||| ||||||||| ||||||||||| ||||| ||||| | ||| |
|
|
| T |
10842124 |
gtgagcttagctctgttagcatggacattgcataatttatgtaggggctgaagttcgaatcccggacactccacttctccatatttaattgtgtaagctc |
10842025 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
10842024 |
tatccactaggctac |
10842010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 138 - 195
Target Start/End: Complemental strand, 14403805 - 14403745
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatat---tatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
14403805 |
ctcagttggtacggatattgcatatatttatatgcaggagccggggttcgaaccctggaca |
14403745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 242
Target Start/End: Original strand, 17058767 - 17058821
Alignment:
| Q |
188 |
cccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||| ||||| |||||||||||| |
|
|
| T |
17058767 |
cccggacaccccacttctccacaattaattgtgtgagctctaaccactaggctac |
17058821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 30734517 - 30734435
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| |||| ||||||||||| ||||||||||||||||||||| | | |||| ||||| ||||||| ||||||||||||| |
|
|
| T |
30734517 |
gtgaatttaactcagttggtataaatattgcatattatatgcaggggtccgggtttgaacctcggacactccacttctccaca |
30734435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 171
Target Start/End: Complemental strand, 42848797 - 42848755
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcag |
171 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42848797 |
tgagcttagctcagttgatagggatattgcatattatatgcag |
42848755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 47528513 - 47528439
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||| ||||| ||||||||||||||| ||| | |||||| |||| ||| | ||||||||||||||||||||||| |
|
|
| T |
47528513 |
tccccgtgagcttagctcagttggtaaggacaatgcataatatacgcaaggtccgaggttcgaaccccggacacc |
47528439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 138 - 203
Target Start/End: Complemental strand, 50199561 - 50199496
Alignment:
| Q |
138 |
ctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
50199561 |
ctcagttggtagggacat-gcattgttatatgcaggggccggggttcgaaccccggacaccccactt |
50199496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 195039 - 195119
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||| |||||||||||| ||||| || ||||| ||||||||||| || |||||||| ||||| |||||||||||| |
|
|
| T |
195039 |
tccctgtgagcgtagctcagttggcagggacat-gcataattatatgcaggggctgaggttcgtaccccagacaccccactt |
195119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 208
Target Start/End: Complemental strand, 5413391 - 5413315
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||||| ||| ||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
5413391 |
agtttaactcagttgttaaagatattgcatattatatgtaggggccga-attcgaatcccggacactccacttctcca |
5413315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #253
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 223
Target Start/End: Complemental strand, 7000983 - 7000934
Alignment:
| Q |
174 |
gccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
7000983 |
gccggggttcgaactccggacaccccacttctccacatttaattgtgtga |
7000934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #254
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 207
Target Start/End: Original strand, 18958549 - 18958626
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatatt-atatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| ||||| ||||||||| ||| ||||||||||||||||| |||||||||| |
|
|
| T |
18958549 |
gtgagtttagctcagttg-tagagatattgtatatttatatgcaggt--cgaagttcgaaccccggacactccacttctcc |
18958626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #255
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 125 - 186
Target Start/End: Original strand, 24631836 - 24631897
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaa |
186 |
Q |
| |
|
|||||||||||| ||||||||||| ||||| |||||| |||||||| || || ||||||||| |
|
|
| T |
24631836 |
cctgtgagtttaactcagttggtaaggataatgcataatatatgcaagatccaaggttcgaa |
24631897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #256
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 38021258 - 38021327
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| | ||| | ||||| |||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
38021258 |
tagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccactt |
38021327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #257
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 39670845 - 39670784
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||||| || |||| |||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
39670845 |
ggttcgaactccagacatcccacttctccacatttaattgtgtgagctctaaccactaggct |
39670784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #258
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 42831954 - 42832022
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | ||||||| |||||||||||| || | ||||| ||||||||||||||||||| |
|
|
| T |
42831954 |
tagctcagttggtagg-acattgcattattatatgcaggggctggggttcaaaccccggacaccccactt |
42832022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #259
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 44579937 - 44579974
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44579937 |
ggttcgaacccctgacaccccacttctccacatttata |
44579974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #260
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 190
Target Start/End: Original strand, 7188614 - 7188682
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
||||| ||||| ||| |||| || ||||||||||| ||||| |||||| ||||| |||||||||||||| |
|
|
| T |
7188614 |
atccccgtgagcttaactcaattagtagggatatttcatataatatgccggagctgaggttcgaacccc |
7188682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #261
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 237
Target Start/End: Original strand, 11344435 - 11344551
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtg |
220 |
Q |
| |
|
|||| ||||| |||||| |||||||||||| | |||||| |||||| || |||| |||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
11344435 |
tccccgtgagcttagcttagttggtagggacaaatgcataatatatgtagaggccggagttcgaaccctggacacctcacttctccacattaaatatgtg |
11344534 |
T |
 |
| Q |
221 |
tgaactctagccactag |
237 |
Q |
| |
|
||| || ||||||||| |
|
|
| T |
11344535 |
tgagcttcagccactag |
11344551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #262
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 237
Target Start/End: Original strand, 11502455 - 11502571
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt-tatatgtg |
220 |
Q |
| |
|
|||| ||||| |||||| |||||||||||| | |||||| |||||| || |||| |||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
11502455 |
tccccgtgagcttagcttagttggtagggacaaatgcataatatatgtagaggccggagttcgaaccctggacacctcacttctccacattaaatatgtg |
11502554 |
T |
 |
| Q |
221 |
tgaactctagccactag |
237 |
Q |
| |
|
||| || ||||||||| |
|
|
| T |
11502555 |
tgagcttcagccactag |
11502571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #263
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 14321499 - 14321411
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| || |||||||||| |||||| ||||||||||||||||||| || || | ||||| |||||| |||| ||||||||||||| |
|
|
| T |
14321499 |
atccccgtaagtttagctccattggtaaggatattgcatattatatgtagaagttggggttcaaaccccaaacactccacttctccaca |
14321411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #264
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 22779222 - 22779298
Alignment:
| Q |
128 |
gtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| |||||||| |||||| |||||| |||||||| ||| |||||| || |||||||||||| ||||||||||| |
|
|
| T |
22779222 |
gtgagcttagctcacttggtaagggataatgcatattttatacaggagtcggggttcgaaccccaaacaccccactt |
22779298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #265
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 240
Target Start/End: Original strand, 39433390 - 39433468
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||||||||| ||||| ||||||||| |||||||||||||| | ||| ||||| | ||||| ||||||||||||||| |
|
|
| T |
39433390 |
tattatatgcaggggccgatgttcgaacctcggacaccccacttattcac-cttataag-gtgaattctagccactaggct |
39433468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #266
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 168
Target Start/End: Complemental strand, 47478915 - 47478875
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47478915 |
gtgagcttaactcagttggtagggatattgcatattatatg |
47478875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #267
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 212
Target Start/End: Original strand, 49253613 - 49253696
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
||||| |||||| |||||||||| ||||||||||||||||||||| ||| |||||| |||| | ||||||||| |||||||| |
|
|
| T |
49253613 |
gtgagcttagctaagttggtagg-atattgcatattatatgcagggattgagattcgaatcccgaataccccacttttccacatt |
49253696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #268
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 193
Target Start/End: Complemental strand, 4069699 - 4069640
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccgga |
193 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| |||| |||| |||||||||| |
|
|
| T |
4069699 |
ttagctcagttggtacagatattgcattatatatgcaggggccggggtttgaaccccgga |
4069640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #269
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 4354203 - 4354125
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| |||||||||||||||| | | ||||| |||||||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
4354203 |
cctgtgagcatagctcagttggtagg-acaatgcattattatatgcaggggccggggttcgaacttcggacaccccactt |
4354125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #270
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 189
Target Start/End: Original strand, 11065117 - 11065184
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccc |
189 |
Q |
| |
|
||||| ||||| ||||||||| || ||| |||||||||||||||||||||| | || ||||| ||||| |
|
|
| T |
11065117 |
atccccgtgagcttagctcagatgatagagatattgcatattatatgcaggggtcggggttcaaaccc |
11065184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #271
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 12973373 - 12973298
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||||| |||||| |||| | |||||||||| |||||| ||| ||| || |||||||||||| |
|
|
| T |
12973373 |
tgagtttagctcatttggtaagggataatgcacaatatatgcaggggccgagattcaaactcctgacaccccactt |
12973298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #272
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 19976613 - 19976574
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
19976613 |
ttatatgcaggggccggggttcgaaccccggacaccccac |
19976574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #273
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 233
Target Start/End: Complemental strand, 23933141 - 23933030
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||| ||| | ||| ||| | || ||||||||| || |||||||||||||| ||| ||| | ||| |
|
|
| T |
23933141 |
atccccgtgagcttagctcagttggtagggacattgtataatttatctaggggtcggggttcgaacttcgaacaccccacttctctacaattaattatgt |
23933042 |
T |
 |
| Q |
222 |
gaactctagcca |
233 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
23933041 |
gagctctagcca |
23933030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #274
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 214
Target Start/End: Original strand, 28317254 - 28317289
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28317254 |
ggttcgaaccccggacatcccacttctccacattta |
28317289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #275
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 34702408 - 34702333
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
34702408 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacacctcactt |
34702333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #276
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 200
Target Start/End: Complemental strand, 52833192 - 52833129
Alignment:
| Q |
138 |
ctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
52833192 |
ctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacatccca |
52833129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #277
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 167
Target Start/End: Complemental strand, 2846776 - 2846738
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatat |
167 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
2846776 |
tgagtttagctcagttgatagggatattgcattttatat |
2846738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #278
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 6000209 - 6000135
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||| ||||||||| |||||||||| ||| | |||||| |||||||| | ||||||||| ||||||||||||| |
|
|
| T |
6000209 |
tccccgtgagtttaactcagttggttaggacaatgcataatatatgcaaggtccgaggttcaaaccccggacacc |
6000135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #279
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 213
Target Start/End: Original strand, 12662690 - 12662775
Alignment:
| Q |
128 |
gtgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt |
213 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||||||||| |||| ||||||| | |||||| | |||||||| |||||| |
|
|
| T |
12662690 |
gtgagcttagctcagttaataagggatattgcatattatatgcaggggccggagttcgaaactcggaca-ctcacttctctacattt |
12662775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #280
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Original strand, 15595728 - 15595770
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
15595728 |
gtgagcttagctcagttggtagggacattgcataatatatgca |
15595770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #281
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Complemental strand, 19396252 - 19396210
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
19396252 |
gtgagtttaactcagttggtagggataatgcataatatatgca |
19396210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #282
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 21247783 - 21247725
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||| ||||||||||| || |||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
21247783 |
tgcattttatatgcaggtttcggggttcgaacctcggacaccccacttctccatattta |
21247725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #283
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 242
Target Start/End: Original strand, 25069538 - 25069600
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||| ||| ||| ||||||| |||| ||||| |
|
|
| T |
25069538 |
gttcgaaccccgaacaccccacttctccatatttaattgtatgagctctagctactaagctac |
25069600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #284
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 208
Target Start/End: Original strand, 25540975 - 25541041
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||||||||||||||| | ||||||| ||| | || |||||||| | ||||||| ||||||||||| |
|
|
| T |
25540975 |
gttggtagggatattgcgttttatatgtaggggtcggggttcgaatctcggacactccacttctcca |
25541041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #285
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 168
Target Start/End: Original strand, 27344472 - 27344522
Alignment:
| Q |
118 |
atttatccctgtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
|||||||| ||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
27344472 |
atttatcctcgtgagcttagctcagttggtagacatattgcatattatatg |
27344522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #286
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 240
Target Start/End: Complemental strand, 27972257 - 27972156
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||| |||||||||| |||||||||| |||| || |||| | ||||||| ||||| ||||||||| || ||||||| ||||||| || ||||||||| |
|
|
| T |
27972257 |
ctcaattggtagggacattgcatatt-tatgtagcggccgggcttcgaactccggaaaccccacttatctacatttaattgtgtgagcttcagccactag |
27972159 |
T |
 |
| Q |
238 |
gct |
240 |
Q |
| |
|
||| |
|
|
| T |
27972158 |
gct |
27972156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #287
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 168
Target Start/End: Original strand, 28867488 - 28867522
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28867488 |
ttagctcagttggtaggaatattgcatattatatg |
28867522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #288
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 242
Target Start/End: Original strand, 36754347 - 36754465
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtga |
223 |
Q |
| |
|
|||||||| |||||||||||| | |||| ||||||||||||||||| | ||| ||| || | ||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
36754347 |
cctgtgagcttagctcagttgacatagatactgcatattatatgcaggggtcgatgtttaaattctggacacctcacttctacacatttaatatgtgtga |
36754446 |
T |
 |
| Q |
224 |
actctagccactaggctac |
242 |
Q |
| |
|
|||| ||| |||||||| |
|
|
| T |
36754447 |
gttctaaccattaggctac |
36754465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #289
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 37403192 - 37403110
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| || |||||||| |||||||||||||||| |||||||||| | ||| ||||||||||||| |||||||||||| |
|
|
| T |
37403192 |
gtgagcttggctcagttagtagggatattgcataatatatgcagggattggagtttgaaccccggacacttcacttctccaca |
37403110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #290
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 38448932 - 38448858
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||| ||||| ||||||||||||||| ||| | |||||| |||||||| | ||| |||||||| |||||||||| |
|
|
| T |
38448932 |
tccccgtgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgaatcccggacacc |
38448858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #291
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 42127684 - 42127603
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||| || | | | |||| ||| ||||||||| ||||||||||||| |
|
|
| T |
42127684 |
gtgagtttaactcaattggtatggatattgcatattatatacaagggtcagggtttgaa-cccggacactccacttctccaca |
42127603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #292
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 7550046 - 7550095
Alignment:
| Q |
161 |
attatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
7550046 |
attatttgcaggggccggggttcgaaccccggattccccacttctccaca |
7550095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #293
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 9768870 - 9768829
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
9768870 |
ttatatgcaggggtcggggttcgaaccccggacaccccactt |
9768829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #294
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 11405490 - 11405531
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
11405490 |
ttatatgcaggggtcggggttcgaaccccggacaccccactt |
11405531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #295
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 19554339 - 19554372
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
19554339 |
ttcgaaccccggacacctcacttctccacattta |
19554372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #296
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 33736771 - 33736880
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
|||||||||||| |||||||| ||| | | |||||| ||| ||| | ||| ||| |||||| | ||||| |||| ||||| ||||| ||||||| ||| |
|
|
| T |
33736771 |
gtgagtttagcttagttggtaaggacaatacatatttgatgtaggggtcgaagtttgaaccctgaacacctcactcctccatatttaattgtgtgagctc |
33736870 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
33736871 |
tagccactag |
33736880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #297
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 37733762 - 37733830
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| ||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
37733762 |
tagctcagttggtagg-acaatgcattattatatgcagtggacggggttcgaaccccggacaccccactt |
37733830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #298
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 191
Target Start/End: Original strand, 38032213 - 38032270
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccg |
191 |
Q |
| |
|
|||| |||| |||||||||||||||||||| ||||||||| | | ||||| ||||||| |
|
|
| T |
38032213 |
ttagatcagctggtagggatattgcatattgtatgcaggatctggggttcaaaccccg |
38032270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #299
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 39434652 - 39434693
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39434652 |
ttatatgtaggagccgatgttcgaacctcggacaccccactt |
39434693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #300
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 197
Target Start/End: Complemental strand, 43109333 - 43109264
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
43109333 |
tgagcttagctcatttggtaagggataatgcaaaatatgtgcaggggccggggttcgaaccccggacacc |
43109264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #301
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 47763474 - 47763405
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||| |||||| ||||||| |
|
|
| T |
47763474 |
tagctcagttggcagggacaatgcattattatatgcaggggccggagttcgaacctcggacatcccactt |
47763405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #302
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 52961143 - 52961102
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |||||||| |
|
|
| T |
52961143 |
ttatatgcaggggccggggttcgaaccccggacgccccactt |
52961102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #303
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 200
Target Start/End: Original strand, 4126899 - 4126971
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
||||||||||||| |||||| |||||| |||| | ||||||||| ||||| ||| |||| |||||||||||| |
|
|
| T |
4126899 |
tgagtttagctcatttggtaagggataatgcacaatatatgcagaggccgatgtttgaacaccggacacccca |
4126971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #304
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 238
Target Start/End: Complemental strand, 5431107 - 5430995
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaac |
225 |
Q |
| |
|
||||| ||| ||||||||||||| | | ||||| ||||||| ||| | || ||||||||| ||||||||||||| ||||||||| | |||||||| | |
|
|
| T |
5431107 |
gtgagcttaactcagttggtaggaacaaatgcattttatatgtaggggtcggggttcgaactttggacaccccacttatccacatttaaaatgtgtgagc |
5431008 |
T |
 |
| Q |
226 |
tctagccactagg |
238 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
5431007 |
tccagccactagg |
5430995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #305
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 16661254 - 16661342
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||||||||| ||||||||| | ||||||| | |||||| ||| ||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
16661254 |
ctgtaagtttagctcggttggtaggaactttgcataatttatgcatgagttagggttcgagccacggacactccacttctccacattta |
16661342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #306
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 242
Target Start/End: Complemental strand, 19246697 - 19246611
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| | ||||||| |||| ||||| |||| |||||||||||||||| |||||||| || ||||| ||||||| | |||||||| |
|
|
| T |
19246697 |
attgcataatttatgcagaggccg-ggttccaaccgcggacaccccacttct-cacatttaaatatgtgagctctagctagtaggctac |
19246611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #307
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 19276009 - 19275929
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||| | |||| | | | ||| ||||||||| | |||||| ||||| |||| ||||| |
|
|
| T |
19276009 |
ttagctcaattggtagggatattgcataatttatgtatgggtcgaagttcgaacctcagacacctcacttttccatattta |
19275929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #308
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 23368807 - 23368743
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
||||||| |||| ||| | |||||| |||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
23368807 |
agggataatgcacattttgtgcagggaccgatgttcgaaccccggacaccccacttattcacatt |
23368743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #309
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 210
Target Start/End: Original strand, 24333581 - 24333649
Alignment:
| Q |
142 |
gttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||||| |||||||||||||| || | ||||||||||| |||| ||||||||||||| |
|
|
| T |
24333581 |
gttggtatggatattaaatattatatgcaggggctggagttcgaaccccaaacactccacttctccaca |
24333649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #310
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 208
Target Start/End: Original strand, 28502590 - 28502670
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| |||||||||||| ||||||| | | || ||||||| ||| | |||||||| ||| ||| |||| ||||||||||| |
|
|
| T |
28502590 |
gtgagcttagctcagttgatagggatgtcgtattttatatgtaggggtcgaggttcaaactccgaacactccacttctcca |
28502670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #311
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 32635135 - 32635215
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| |||| |||| || |||||| | ||||| |||||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
32635135 |
tcccagtgagattaggtcagctgctagggacactgcattatatatgcaggggttggggttcgaaccccggacaccccactt |
32635215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #312
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 174
Target Start/End: Original strand, 32977649 - 32977689
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggag |
174 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32977649 |
ttagctcagttggtataaatattgcatattatatgcaggag |
32977689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #313
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 33229745 - 33229658
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||| ||| ||||||||||||| | | |||||| ||||||||| ||| | ||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
33229745 |
ctgtgagcttaactcagttggtaggaacaatgcataatatatgcagaggcc-atattcaaactccgaacaccccacttctccacattta |
33229658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #314
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 203
Target Start/End: Complemental strand, 34560432 - 34560358
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| |||||||| | | | | ||||||||||| |||||||||||||| |
|
|
| T |
34560432 |
gtgagtttagctcagttggtagg-ataatgcattattatatgtatgggtc-aggttcgaacctcggacaccccactt |
34560358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #315
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 172
Target Start/End: Complemental strand, 37626232 - 37626180
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
37626232 |
ttatccccgtgagcttacctcagttggtagggatattatattttatatgcagg |
37626180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #316
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 192
Target Start/End: Complemental strand, 41763216 - 41763152
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccgg |
192 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||| | ||| ||||| |||||||| |
|
|
| T |
41763216 |
gtgagcttagctcagttggtagggataatgcataaaatatgcaaggtccggggttcaaaccccgg |
41763152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #317
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 214
Target Start/End: Original strand, 42735894 - 42735970
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||||||||| | |||||| |||||||||| | | |||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
42735894 |
ctcatttggtagggaaaatgcataatatatgcaggggtctgggtttgaattccggacaccccacttctctacattta |
42735970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #318
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 50533077 - 50533156
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||||||||| | |||||||| |||||||||| | || ||||| |||| |||| |||||||| |||||||||| |
|
|
| T |
50533077 |
ttagctcagttggtagaaacattgcataatatatgcaggggtcggagttcg-accctggacgccccacttatccacattta |
50533156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #319
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 52773322 - 52773374
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
174 |
Q |
| |
|
||||| ||||| |||||||| ||||| || ||||||||||||||||| ||||| |
|
|
| T |
52773322 |
atcccggtgagcttagctcacttggtgggaatattgcatattatatgtaggag |
52773374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 10899 - 10778
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtg |
10800 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
10799 |
tgagctctagccactaggctac |
10778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 186)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 17441912 - 17441791
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
17441813 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
17441812 |
tgagctctagccactaggctac |
17441791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 19953901 - 19953780
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg |
19953802 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
19953801 |
tgagctctagccactaggctac |
19953780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 33573811 - 33573935
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||| ||| | | |
|
|
| T |
33573811 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccacaattaaatt |
33573910 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
33573911 |
gtgtgagctctagccactaggctac |
33573935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 10934595 - 10934717
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
10934595 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
10934694 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
10934695 |
gtgagttctagccactaggctac |
10934717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 32611620 - 32611506
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| ||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctc |
32611521 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32611520 |
tagccactaggctac |
32611506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 7207841 - 7207962
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||| ||| | |||| |
|
|
| T |
7207841 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccacaattaaattgtg |
7207940 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
7207941 |
tgagctctagccactaggctac |
7207962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 31802048 - 31802171
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
31802048 |
ttatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattg |
31802147 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||||||| |||| |
|
|
| T |
31802148 |
tgtgagctctagccactagactac |
31802171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 117 - 242
Target Start/End: Complemental strand, 3794251 - 3794125
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||||||| ||| | |
|
|
| T |
3794251 |
aattgatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaa |
3794152 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
3794151 |
ttgtgtgagctctagccactaggctac |
3794125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 2251841 - 2251957
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt--atatgtgtgaac |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||| | |||||||| | |
|
|
| T |
2251841 |
gtgagcttagctcagttggtagggatattgcatactatatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaaaatgtgtgagc |
2251940 |
T |
 |
| Q |
226 |
tctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
2251941 |
tctggccactaggctac |
2251957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 28148794 - 28148685
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
28148794 |
ttagctcagttggtagggatattgcatattatatgcaggagccgggtttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagcc |
28148695 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
28148694 |
actaggctac |
28148685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 9246458 - 9246334
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-t |
217 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||||||| ||| | | |
|
|
| T |
9246458 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccacaattaaatt |
9246359 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
9246358 |
gtgtgagatctagccactaggctac |
9246334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 361159 - 361281
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgt |
219 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||| | || | |
|
|
| T |
361159 |
tatccatgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggttcgaactccagacaccccacttctccatatttaaaatat |
361258 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||| ||||| |
|
|
| T |
361259 |
gtgagctctagccactatgctac |
361281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 7545325 - 7545447
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||| ||| | ||| |
|
|
| T |
7545325 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccccgaacaccccacttctccacaattaaattgt |
7545424 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||| |||| |
|
|
| T |
7545425 |
gtgagctctagccactagactac |
7545447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 9435622 - 9435743
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||| |||||||||||| ||||| ||| |
|
|
| T |
9435622 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacactccacttctccacaatttaattgt |
9435721 |
T |
 |
| Q |
220 |
gtgaactctagccactaggcta |
241 |
Q |
| |
|
|||| ||||||||| ||||||| |
|
|
| T |
9435722 |
gtgagctctagccattaggcta |
9435743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 29284263 - 29284384
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgaaggggccggagttcgaaccccggacaccccacttctccacaattaaattgtg |
29284362 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
| | ||||||||||||||||| |
|
|
| T |
29284363 |
taagttctagccactaggctac |
29284384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 743566 - 743681
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| || || |
|
|
| T |
743566 |
gtgagcttagctcagttggtagggatattgcatattagatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagct |
743665 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
743666 |
ctagccactagactac |
743681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 9704412 - 9704534
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || || |||||||||| ||| | || |
|
|
| T |
9704412 |
ttatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc-gatactccgcttctccacaattaaattg |
9704510 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
9704511 |
tgtgagctctagccactaggctac |
9704534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 128 - 241
Target Start/End: Original strand, 3294767 - 3294881
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||||||| |||| ||| | ||||||| | |
|
|
| T |
3294767 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttcttcacaattaaattgtgtgagtt |
3294866 |
T |
 |
| Q |
227 |
ctagccactaggcta |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3294867 |
ctagccactaggcta |
3294881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 117 - 242
Target Start/End: Complemental strand, 7865433 - 7865307
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttat |
215 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||| |||||| |||||| |||||||||||| ||||| |
|
|
| T |
7865433 |
aatttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggtttgaaccctggacactccacttctccacaatttaa |
7865334 |
T |
 |
| Q |
216 |
atgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||||| ||||| |
|
|
| T |
7865333 |
ttgtgtgagttctagccactaagctac |
7865307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 10517195 - 10517317
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||| ||||||||||| ||||||||||| | || |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
10517195 |
tatccccgtgagcttagctcagttggtatggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccacaattaaattgt |
10517294 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
10517295 |
gtgagctctagccactaggctac |
10517317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 30885644 - 30885522
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||| |||| || | |||||||||||| ||||| ||| |||||||| ||||| ||| |
|
|
| T |
30885644 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatacaggggctggggttcgaaccccagacactccatttctccacaatttaattgt |
30885545 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30885544 |
gtgaactctagccactaggctac |
30885522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 121 - 210
Target Start/End: Original strand, 15091444 - 15091533
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
15091444 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaatcccggacaccccacttctccaca |
15091533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 27218893 - 27219002
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||| | |||||||||||||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
27218893 |
ttagctcagttgatagggatattgcatattatatgtaggagccgggattcgaaccccggacactccacttctccacaattaaattgtgtgagctctagcc |
27218992 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
27218993 |
actaggctac |
27219002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 30704957 - 30705078
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||||||| ||||||| ||| |||| |||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
30704957 |
atccccgtgagcttagttcagttggtagggatattgcatgttatatgtaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtg |
30705056 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||| ||||||| |
|
|
| T |
30705057 |
tgagctctagccaccaggctac |
30705078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 16966455 - 16966347
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | | || ||||| ||| |||||||| ||||||||||| |||||||||||| ||||||| ||| |
|
|
| T |
16966455 |
ttagctcagttggtagggatattgcatattatatgcaagtgtcggggttcaaactccggacactccacttctccatatttatatgtgttaactctaacca |
16966356 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
16966355 |
ctaggctac |
16966347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 7177290 - 7177413
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| || ||||||||||| || | |||||||||||| ||||||||||||||||||| ||| | | |
|
|
| T |
7177290 |
ttatccccgtgagcttagctcagttggtagggatattgtattttatatgcaggggctggggttcgaaccccagacaccccacttctccacaattaaacag |
7177389 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
7177390 |
tgtgagctctagccactaggctac |
7177413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 13116699 - 13116576
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||||| ||| ||||||||||||||| |||||| ||||||||||||| | |||| ||||||||||||||||||||| |||||||||| ||| | || |
|
|
| T |
13116699 |
ttatccctgcgagcttagctcagttggtaaggatatcacatattatatgcaagggccggggttcgaaccccggacacccctcttctccacaattaaattg |
13116600 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
13116599 |
tgtgagctctagccactaggctac |
13116576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 24319011 - 24319130
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||| | |||||||| |||| |||||||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
24319011 |
tccccgtgagtttagttcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacactccacttctccacaattaattgtgtg |
24319110 |
T |
 |
| Q |
223 |
aactctagccactaggctac |
242 |
Q |
| |
|
| ||||||||| |||||||| |
|
|
| T |
24319111 |
agctctagccattaggctac |
24319130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 2816894 - 2817008
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| ||||||||||| || ||| ||||||| |||||||||||||||||||||| ||| | ||||||| ||| |
|
|
| T |
2816894 |
tgagcttagctcaattggtagggatattgcatgttatatgcaggggctgagattcgaactccggacaccccacttctccacaattaaattgtgtgagctc |
2816993 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2816994 |
tagccactaggctac |
2817008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 8297624 - 8297742
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| |||||| ||||||||||| |||| |||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
8297624 |
atccccgtgagcttagctcaattggtagggatgttgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtg |
8297723 |
T |
 |
| Q |
221 |
tgaactctagccactaggc |
239 |
Q |
| |
|
||| ||||| ||||||||| |
|
|
| T |
8297724 |
tgagctctaaccactaggc |
8297742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 28030860 - 28030981
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca-tttatatgt |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||| ||||||||||||| |||| ||| |
|
|
| T |
28030860 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccctggacactccacttctccacagtttaattgt |
28030959 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
||| | |||||||||||||||| |
|
|
| T |
28030960 |
gtgcgc-ctagccactaggctac |
28030981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 119 - 240
Target Start/End: Original strand, 32166363 - 32166485
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatat |
217 |
Q |
| |
|
||||| || ||||| |||||||| |||||||||||||||||||||||||||||| |||| | || ||||||||||||| |||||||||||| ||||| | |
|
|
| T |
32166363 |
tttattcccgtgagcttagctcaattggtagggatattgcatattatatgcaggggccgggatttgaaccccggacactccacttctccacaatttaatt |
32166462 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggct |
240 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
32166463 |
gtgtgagctctagccactaggct |
32166485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 3795835 - 3795726
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || | |||||||||| | ||||| |||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
3795835 |
ttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacctcagacactccacttctccacaatttaattgtgtgagctctagcc |
3795736 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
3795735 |
actaggctac |
3795726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 9372274 - 9372153
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| | || ||||||||||| |||||| |||||||||||| ||||| |||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccacaatttaattgtg |
9372175 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||| |||||||||| |
|
|
| T |
9372174 |
tgagttctagctactaggctac |
9372153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 19892349 - 19892228
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||||||||||||||| ||| | || |||||||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgtaggggtcggggttcgaaccccggacactccacttctccacaatttaattgtg |
19892250 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
19892249 |
agagctctagccactaggctac |
19892228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 31104878 - 31104999
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| |||| ||||||| |||||||||| ||||||||||||||| |||| ||||||| ||||||||||||||||||||||||| | ||||| |
|
|
| T |
31104878 |
tatccccgtgagcttagttcagttgatagggatattacatattatatgcaggggccggagttcgaatcccggacaccccacttctccacattaaaatgtg |
31104977 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| || ||||| |
|
|
| T |
31104978 |
tgagctctagccattatgctac |
31104999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 978207 - 978119
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||| | || ||||||||| |||||||||||||||||||||| |
|
|
| T |
978207 |
atccccgtgagtttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacaccggacaccccacttctccaca |
978119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 216201 - 216324
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| |||||||| |||||||||||||||||| ||||||||||| | | |||||||||| ||||||||||||||||||||| ||| | || |
|
|
| T |
216201 |
ttatcccagtgagcttagctcaattggtagggatattgcatgttatatgcagggtctggggttcgaacctcggacaccccacttctccacaattaaattg |
216300 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||| |||||||||||| |
|
|
| T |
216301 |
tgtgagctctaaccactaggctac |
216324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 3640517 - 3640632
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||| | |||| |||||||||| ||||||| |||||||||||| ||||| ||||||| || |
|
|
| T |
3640517 |
gtgagcttagctcagttggtagggatattgcatagtatatgcaagggccggggttcgaacctcggacactccacttctccacaatttaattgtgtgagct |
3640616 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
3640617 |
ctagccactagactac |
3640632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 10483611 - 10483488
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||| ||||||||||| | || |||||||||||||||||| ||||||||||||| ||| | || |
|
|
| T |
10483611 |
ttatccccgtgatcttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccacaattaaattg |
10483512 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
| ||| ||||||||| |||||||| |
|
|
| T |
10483511 |
tatgagctctagccattaggctac |
10483488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 22997339 - 22997454
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||| ||| | || |||||||||||||||||||| ||||||||||| ||| | ||||||| || |
|
|
| T |
22997339 |
gtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagct |
22997438 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
22997439 |
ctagccactagactac |
22997454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 23791062 - 23790947
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||| ||| | || |||||||||||||||||||| ||||||||||| ||| | ||||||| || |
|
|
| T |
23791062 |
gtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctacttctccacaattaaattgtgtgagct |
23790963 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
23790962 |
ctagccactagactac |
23790947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 120 - 238
Target Start/End: Original strand, 31935094 - 31935213
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||| ||||||||||| | || |||||||||||||||||| |||||||||||| ||||| || |
|
|
| T |
31935094 |
ttatctctgtgagcttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccacaatttaattg |
31935193 |
T |
 |
| Q |
219 |
tgtgaactctagccactagg |
238 |
Q |
| |
|
||| | ||||||||| |||| |
|
|
| T |
31935194 |
tgtaagctctagccattagg |
31935213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 32050032 - 32049917
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||| |||||||||||||||||||||||||||||||||| ||||||||| ||| |||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
32050032 |
gtgagcttaactcagctggtagggatattgcatattatatgcaggagccggggttcgaactccgaacactccacttctccacaattaaattgtgtgagct |
32049933 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
32049932 |
ctagccaccaggctac |
32049917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 15964009 - 15963895
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| || | ||||||||||| |||||| |||||||||||| ||||| ||||||| || |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatgcaggggctggggttcgaaccctggacactccacttctccacaatttaattgtgtgagttc |
15963910 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15963909 |
tagccactaggctac |
15963895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 119 - 199
Target Start/End: Original strand, 1968990 - 1969070
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacccc |
199 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
1968990 |
tttatccccgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacacccc |
1969070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 119 - 242
Target Start/End: Original strand, 6210048 - 6210172
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatat |
217 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||||| ||||| |||||||||||| ||||| | |
|
|
| T |
6210048 |
tttatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccacaatttaatt |
6210147 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| |||| |||||| ||||| |
|
|
| T |
6210148 |
gtgtgagttctaaccactatgctac |
6210172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 133 - 236
Target Start/End: Complemental strand, 13158771 - 13158667
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagc |
231 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||| ||| | ||||||| ||||||| |
|
|
| T |
13158771 |
tttagctaagttggtagggatattgcatattatatgcagagactggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagc |
13158672 |
T |
 |
| Q |
232 |
cacta |
236 |
Q |
| |
|
||||| |
|
|
| T |
13158671 |
cacta |
13158667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 133 - 236
Target Start/End: Complemental strand, 13163627 - 13163523
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagc |
231 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||| ||| | ||||||| ||||||| |
|
|
| T |
13163627 |
tttagctaagttggtagggatattgcatattatatgcagagactggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagc |
13163528 |
T |
 |
| Q |
232 |
cacta |
236 |
Q |
| |
|
||||| |
|
|
| T |
13163527 |
cacta |
13163523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 16913961 - 16913853
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||| | || |||||||||||||||||| ||| ||||||||||| |||||||| | ||||| ||| |
|
|
| T |
16913961 |
ttagctctgttgataaggatattgcatattatatgcaggggtcggggttcgaaccccggacactccatttctccacattcatatgtgttagctctaacca |
16913862 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
16913861 |
ctaggctac |
16913853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 121 - 209
Target Start/End: Complemental strand, 17454819 - 17454731
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
209 |
Q |
| |
|
|||||| ||||| ||| |||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| |
|
|
| T |
17454819 |
tatccccgtgagcttatctcagttggtagagatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
17454731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 238
Target Start/End: Original strand, 492905 - 493016
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||| | ||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| ||| | ||||||| || |
|
|
| T |
492905 |
gtgagcttagctcagttggcaaggatattgcatattatatgcaggggccggggttcgaaccctggacaccccacttctccacaattaaattgtgtgagct |
493004 |
T |
 |
| Q |
227 |
ctagccactagg |
238 |
Q |
| |
|
|||| |||||| |
|
|
| T |
493005 |
gtagctactagg |
493016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 9888592 - 9888477
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| |||||||||| || |||| ||||||||||||| ||||||||||||| ||| | | ||||| || |
|
|
| T |
9888592 |
gtgagtttaactcagttggtagggatattgtatattctatgcaggagtcggggtttgaaccccggacactccacttctccacaattaaattatgtgagct |
9888493 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
9888492 |
ctaaccactaggctac |
9888477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 128 - 234
Target Start/End: Original strand, 1435812 - 1435918
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||| |||||| |||||||||||| ||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||| ||||||| ||| |
|
|
| T |
1435812 |
gtgagcttaactcagtaggtagggatattacatattatatgcaggggccagggttcgaaccccggacattccacttctccacatttaattgtgtgagctc |
1435911 |
T |
 |
| Q |
228 |
tagccac |
234 |
Q |
| |
|
||||||| |
|
|
| T |
1435912 |
tagccac |
1435918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 239
Target Start/End: Complemental strand, 6419156 - 6419039
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||||||| |||||||||||| |||||||||||||||||||||| ||| |||||||| |||||||| |||||||||||||||||| ||| |
|
|
| T |
6419156 |
tatccccgtgagtttaactcagttggtagagatattgcatattatatgcagggtccggggttcgaa-cccggacaacccacttctccacatttaattgta |
6419058 |
T |
 |
| Q |
221 |
tgaactctagccactaggc |
239 |
Q |
| |
|
||| |||||| || ||||| |
|
|
| T |
6419057 |
tgagctctagtcattaggc |
6419039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 19374915 - 19374793
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgt |
219 |
Q |
| |
|
||||||| ||||| ||||||||||| ||||| ||||||||||||||||||||| | | ||||||||||||| |||| ||||||||||| ||||| ||| |
|
|
| T |
19374915 |
ttatccccgtgagcttagctcagttagtaggaatattgcatattatatgcaggggttggggttcgaaccccgaacactccacttctccaaatttaattgt |
19374816 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
| || || ||||||||||||||| |
|
|
| T |
19374815 |
gagagctgtagccactaggctac |
19374793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 142 - 242
Target Start/End: Original strand, 33646851 - 33646953
Alignment:
| Q |
142 |
gttggtagggatattgcatatt-atatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggc |
239 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | || |||||||||| ||||||||||||||||||||| ||| | ||||||| ||||||||||||||| |
|
|
| T |
33646851 |
gttggtagggatattgcatatttatatgcaggggtcggggttcgaacctcggacaccccacttctccacaattaaattgtgtgagctctagccactaggc |
33646950 |
T |
 |
| Q |
240 |
tac |
242 |
Q |
| |
|
||| |
|
|
| T |
33646951 |
tac |
33646953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 4661093 - 4661214
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc-acatttatatgtg |
220 |
Q |
| |
|
||||| ||||| |||||| |||||||||||||||||||||||||||||||| | | | |||||||||| |||| |||||||||| | |||||| |||| |
|
|
| T |
4661093 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggggttgggtttcgaaccccagacattccacttctccaaaatttatttgtg |
4661192 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
4661193 |
tgagctctagccactaggctac |
4661214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 5052146 - 5052026
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||| |||| ||||||||||||| || |||| ||||||||||||| |||| |||||||| ||| | |||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttatatgcaggagtcggggtttgaaccccggacactccac-tctccacaattaaattgtg |
5052048 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
5052047 |
tgagctctagccactaggctac |
5052026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 131 - 242
Target Start/End: Complemental strand, 31803660 - 31803547
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||| |||| | ||||||||| ||||||| |||||||||||| ||| | ||||||| |||| |
|
|
| T |
31803660 |
agtttagctcagttggtagggatattgcatatttatatgtaggggccgggattcgaaccctggacacctcacttctccacaattaaattgtgtgagctct |
31803561 |
T |
 |
| Q |
229 |
agccactaggctac |
242 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
31803560 |
agccactagactac |
31803547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 32621655 - 32621534
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| |||||||| |||||||||||||||| | ||||| ||||||||||| |||| |||||||| ||| |||||||||||||||||||||| | ||||| |
|
|
| T |
32621655 |
tcccagtgagtttcgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaatcccagacaccccacttctccacatttaaaatgtg |
32621556 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| |||||||||||||| |
|
|
| T |
32621555 |
tgagctccagccactaggctac |
32621534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 8857087 - 8857201
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||||||||||||||| |||| |||||||||| ||||||||||||||| ||| | |||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaacc-------ccccacttctccacaattaaattgtg |
8857179 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
8857180 |
tgagctctagccactaggctac |
8857201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 12284124 - 12284239
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||||||||||| |||||||||||||| | || ||||||||| ||||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
12284124 |
gtgagcttaactcagttggtagggatattgaatattatatgcaggtgtcggggttcgaactccggaaactccacttctccacaattaaattgtgtgagct |
12284223 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
12284224 |
ctagccactagactac |
12284239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 19618804 - 19618678
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatatt--atatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||||||||||||||||| |||| |||| || | |||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
19618804 |
tttagccccgtgagtttagctcaattggtagggatattgcatattatatatacaggggctggggttcgaaccccggacaccccacttctccacaattaaa |
19618705 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| ||| | |||||||||||| |
|
|
| T |
19618704 |
ttgtatgagctcgaaccactaggctac |
19618678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 34432864 - 34432749
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||| | | |||||||||||| ||||| |||||||||||| ||||| | |||||||| |
|
|
| T |
34432864 |
gtgagcttagttcagttggtagggatattgcatattatatgcagaggttggggttcgaaccccagacactccacttctccacaatttaattatgtgaact |
34432765 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
34432764 |
ctaaccactaggctac |
34432749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 222
Target Start/End: Original strand, 10628617 - 10628711
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| || | |||||||| ||||||||| |||| ||||||||||||| |||| |
|
|
| T |
10628617 |
gtgagtttagctcggttggtagggatattgcatattatatgcaggggctggtgttcgaacatcggacaccctacttttccacatttatatatgtg |
10628711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 22574866 - 22574988
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||| ||||||||||| | | ||||||||||||| |||| ||||||||||||| ||| | ||| |
|
|
| T |
22574866 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggttggggttcgaaccccgcacactccacttctccacaattaaattgt |
22574965 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||| ||||||| |||| |
|
|
| T |
22574966 |
gtgagctctaaccactagactac |
22574988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 129 - 210
Target Start/End: Original strand, 7153792 - 7153873
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatgcaggggccgaggttcgaatcccggacactccacttcttcaca |
7153873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 18904262 - 18904383
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtg |
220 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| | || ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
18904262 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaaatgtg |
18904361 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||| ||||||||| |||| |
|
|
| T |
18904362 |
tgagctccagccactagactac |
18904383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 28222876 - 28222980
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||||||| | ||| | ||||||| ||||| |||||| |
|
|
| T |
28222876 |
ctcagttggtagggatattgcatattatatgcagaggccggggttcgaa-cccggacactccacttctccataattaaattgtgtgagctctaaccacta |
28222974 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
28222975 |
ggctac |
28222980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 32813723 - 32813602
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||| |||||||||| ||||||||||||||||||||||| |||| ||||||||||||||| || |||||||| |||| ||| | |||| |
|
|
| T |
32813723 |
atccccgtgagcttagttcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggatactccacttcttcacaattaaattgtg |
32813624 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| || ||||||||| |||| |
|
|
| T |
32813623 |
tgagctacagccactagactac |
32813602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 27667157 - 27667249
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| ||||| || |||||||||||||||| | ||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27667157 |
tccccgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccacattta |
27667249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 210
Target Start/End: Complemental strand, 28237328 - 28237236
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgagg-ttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| || || |||||| |||||| ||||||||||||| |
|
|
| T |
28237328 |
tttatcctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggatttgaaccctggacactccacttctccaca |
28237236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 201
Target Start/End: Original strand, 607184 - 607262
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
607184 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgctcg-gccgaggttcgaaccccggacactccac |
607262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 7418281 - 7418396
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||| |||||||||||||||||||||||||||||| ||| |||||||||| |||||| ||||||||||| ||||| ||||||| || |
|
|
| T |
7418281 |
gtgagcttaactcatttggtagggatattgcatattatatgcaggggcctgagttcgaaccctggacactccacttctccataatttaattgtgtgagct |
7418380 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
7418381 |
ctagccactcggctac |
7418396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 2488953 - 2488840
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| | | |||||| | || |||||||||||||||| ||||||||| || ||| || ||||||| ||| |
|
|
| T |
2488953 |
gtgagtttagctcagttggtagggacattgtataatttctgcaggggtcggagttcgaaccccggacatcccacttcttcatattaat-tgtgtgagctc |
2488855 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2488854 |
tagccactaggctac |
2488840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 138 - 208
Target Start/End: Original strand, 7072091 - 7072161
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||| | ||||||||| |
|
|
| T |
7072091 |
ctcagttggtagggatattacatattatatgcaggagtcggggttcgaaccccggacactctacttctcca |
7072161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 32788921 - 32788807
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||| | |||||||| | | ||||||||| ||||||||||||||||| |||||||| ||| ||| ||| |
|
|
| T |
32788921 |
gtgagtttagttcagttggtagggtcattgtataatttatgcaggggttggggttcgaactccggacaccccacttctacacatttaattgtatgagctc |
32788822 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32788821 |
tagccactaggctac |
32788807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 2426073 - 2426182
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| | | | |||||||||||||||||| |||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
2426073 |
ttagctcagttggtaggaatattacatattatatgcaagggttggggttcgaaccccggacactccacttctccacaatttaattgtgtgagctctagcc |
2426172 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
| ||| |||| |
|
|
| T |
2426173 |
aatagactac |
2426182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 132 - 233
Target Start/End: Original strand, 5694921 - 5695022
Alignment:
| Q |
132 |
gtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagc |
231 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| | | ||| ||||| ||||||||||||||||||||||| | |||||||| ||| ||| |
|
|
| T |
5694921 |
gtttaggtcagttggtagggatattgtatattatatgcaggggtaggagtttgaacctcggacaccccacttctccacattaaaatgtgtgagctccagc |
5695020 |
T |
 |
| Q |
232 |
ca |
233 |
Q |
| |
|
|| |
|
|
| T |
5695021 |
ca |
5695022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 7581041 - 7581162
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||| || ||||||||||||||||| ||||||||||| | | ||||||||| || |||||| ||||||||||| ||| | |||| |
|
|
| T |
7581041 |
atccccgtgagcttagcttagctggtagggatattgcattttatatgcaggggttggggttcgaacgccagacaccttacttctccacaattaaattgtg |
7581140 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
7581141 |
tgagctctagccactaggctac |
7581162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 10913140 - 10913031
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca-catttatatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||||||| | || |||||||||||| ||||| ||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
10913140 |
ttagctcagctggtggagatattgcatattatatgcaggggtcggggttcgaaccccagacactccacttctccataatttaattgtgtgagctctagcc |
10913041 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||| ||||| |
|
|
| T |
10913040 |
actaagctac |
10913031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 11421058 - 11420946
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||||||||| |||||||| ||| ||||| |||||||| | |||||||| |||| |||||||| |||||||| ||| ||||||||| |||| ||||||| |
|
|
| T |
11421058 |
tccctgtgagcttagctcaactggcagggacattgcataatttatgcagg-gccggggttcgaaacccggacatcccgcttctccacgtttaaatgtgtg |
11420960 |
T |
 |
| Q |
223 |
aactctagccacta |
236 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
11420959 |
agctctagccacta |
11420946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 13732809 - 13732929
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||||| | |||| |||| |||||||||||| | ||||||||||| ||| | ||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaag-gccggagttcaaaccccggacactctacttctccacaattaaattgta |
13732907 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
13732908 |
tgagctctaaccactaggctac |
13732929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 145 - 242
Target Start/End: Original strand, 17534867 - 17534964
Alignment:
| Q |
145 |
ggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||| |||||||| | |||||||| |||| ||||||||| ||||||||| ||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
17534867 |
ggtagggacattgcataatttatgcaggggccggggttcgaactccggacacctgacttctccacatttaattgtgtgagttctagccactaggctac |
17534964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 20584070 - 20584191
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||||||||| ||| |||||||| ||| ||||||||||||||||| ||||||||| || |||| |||| |||| ||||||||||||| ||| | |||| |
|
|
| T |
20584070 |
atccctgtgagcttaactcagttgatagcgatattgcatattatatacaggagccggagtacgaatcccgcacactccacttctccacaattaaattgtg |
20584169 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| ||||||||| ||| |||| |
|
|
| T |
20584170 |
tgagctctagccattagactac |
20584191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 141 - 201
Target Start/End: Complemental strand, 894686 - 894626
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
894686 |
agttggtagggatattgcatattatatgcaggggtcgaggttcgaaccccggacactccac |
894626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 128 - 232
Target Start/End: Original strand, 3196622 - 3196729
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatat--tatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaa |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| |||||||||||| | ||||||||||||||| || ||||||||||||| ||| | ||||||| |
|
|
| T |
3196622 |
gtgagcttagctcagttggtagggatattacatattatatatgcaggagttggggttcgaaccccggatactccacttctccacaattaaattgtgtgag |
3196721 |
T |
 |
| Q |
225 |
ctctagcc |
232 |
Q |
| |
|
|||||||| |
|
|
| T |
3196722 |
ctctagcc |
3196729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 203
Target Start/End: Complemental strand, 6658643 - 6658563
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| |||||| |||| ||||||| |||||||| |||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
6658643 |
tccccgtgagcttagcttagttagtagggaaattgcataatatatgcaggggccggggttcgaaccccggacaccccactt |
6658563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 122 - 210
Target Start/End: Original strand, 31705896 - 31705984
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||||||||| |||||| ||| | || |||||||||| ||||||||||||||||||||| |
|
|
| T |
31705896 |
atccccgtgagcttagctcagttggtatggatattgcattatatatgtaggggtcggggttcgaaccacggacaccccacttctccaca |
31705984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 122 - 201
Target Start/End: Original strand, 4408355 - 4408434
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||| | ||||| |||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccacagacactccac |
4408434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 7328714 - 7328599
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| |||||| |||| | || ||||| ||| | ||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
7328714 |
gtgagcttaactcagttggtagggatattgcattttatatccaggggtcggggttcaaactctcgacactccacttctccacaattaaattgtgtgagct |
7328615 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7328614 |
ctagccactaggctac |
7328599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 8439678 - 8439760
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| | || | |||||| || |||||| | ||||||||||| |
|
|
| T |
8439678 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcgggattcgaatcctggacactcaacttctccaca |
8439760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 236
Target Start/End: Complemental strand, 14709076 - 14708978
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| |||| ||||||||| |||||||| |||||||||| | ||||| ||||||| ||||||||||| |
|
|
| T |
14709076 |
tcagttggtagagatattgcatattatatgtaggggccggggttcgaactccggacactccacttctcctcaatttaattgtgtgagttctagccacta |
14708978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 23610386 - 23610272
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| | |||||||| | || ||||| ||| | ||||||||||||||| |||| ||| |||| || ||| |
|
|
| T |
23610386 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggggtcggggttcaaacgctggacaccccacttcttcacaattaattgtgcgagctc |
23610287 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23610286 |
cagccactaggctac |
23610272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 24758735 - 24758857
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| ||| |||| ||||||||||||| |||| ||||||||||| | || ||||||||||||||| || |||||||||||| ||| | ||| |
|
|
| T |
24758735 |
tatccccgtgagcttaactcaattggtagggatatcgcattttatatgcaggggtcggggttcgaaccccggatacttcacttctccacaattaaattgt |
24758834 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| || |||||||| |||||| |
|
|
| T |
24758835 |
gtgagctatagccactgggctac |
24758857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 32670120 - 32670006
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttat-atgtgtgaactc |
227 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||| | |||||||| || | |||||||||||| ||||||| ||||||||| |||||| |||||||| ||| |
|
|
| T |
32670120 |
tgagcttagctcaattggtaggaatattgcataatttatgcaggggcaggggttcgaacccctgacaccctacttctccatatttataatgtgtgagctc |
32670021 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
32670020 |
caaacactaggctac |
32670006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 241
Target Start/End: Original strand, 34268280 - 34268398
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtg |
222 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||| |||||||| | |||||||| | | ||||||||||||| |||||| |||||| |||| ||| |||||| |
|
|
| T |
34268280 |
tccccgtgagcttagctccgttggtagggacattgcataatttatgcaggggtcagggttcgaaccccgaacaccctacttcttcacaattaattgtgtg |
34268379 |
T |
 |
| Q |
223 |
aactctagccactaggcta |
241 |
Q |
| |
|
| ||||||||| ||||||| |
|
|
| T |
34268380 |
agctctagccattaggcta |
34268398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 242
Target Start/End: Complemental strand, 30347 - 30258
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||| |||||||| ||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
30347 |
attgcatattatatgcaggggccggggttcgaaccctggacactccacttcttcacaatttaattgtgtgagttctagccactaggctac |
30258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 128 - 208
Target Start/End: Complemental strand, 7897186 - 7897105
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| |||| |||||||||||||||| |||||| |||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
7897186 |
gtgagcttagatcagttggtagggataaatgcataatatatgcaggggtcggggttcgaaccccggacaccccacttctcca |
7897105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 125 - 206
Target Start/End: Original strand, 15285543 - 15285624
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctc |
206 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||| |||||| |||| |||||| || || ||||||||| |
|
|
| T |
15285543 |
cctgtgagtttaactcagttggtagggatattacatattatatgcatgagccggggtttgaaccctagagactccacttctc |
15285624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 135 - 223
Target Start/End: Original strand, 606997 - 607085
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||| || |||||||||||||||| | |||||||| ||||||||||||| ||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
606997 |
tagctcaattagtagggatattgcataatttatgcagggaccgaggttcgaactccgaacaccccacttctccacaattaattgtgtga |
607085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 134 - 241
Target Start/End: Complemental strand, 2500575 - 2500467
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || | || ||||||| |||||||| ||||||||||||| ||| | ||||||| |||||| | |
|
|
| T |
2500575 |
ttagcttagttggtagggatattgcatattatatgtagaggtcggagttcgaattccggacactccacttctccacaattaaattgtgtgagctctagac |
2500476 |
T |
 |
| Q |
233 |
actaggcta |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
2500475 |
actaggcta |
2500467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 135 - 242
Target Start/End: Original strand, 11301377 - 11301485
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| | |||||||| | ||||||| |||||||| |||| ||| | ||||||| ||||||| | |
|
|
| T |
11301377 |
tagctcagttgataggaatattgcatattatatgcaggagttggggttcgaatctcggacactccacttcttcacaattaaattgtgtgagctctagcaa |
11301476 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
|||| |||| |
|
|
| T |
11301477 |
ctagactac |
11301485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 203
Target Start/End: Complemental strand, 20568357 - 20568277
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| ||||| ||||||||||||||| ||| |||||||| |||||||||| | || ||||||||||||| ||||||||||| |
|
|
| T |
20568357 |
tccccgtgagcttagctcagttggtaaggacattgcataatatatgcaggggtcggggttcgaaccccgaacaccccactt |
20568277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 242
Target Start/End: Complemental strand, 29646561 - 29646501
Alignment:
| Q |
182 |
tcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
29646561 |
tcgaaccccggacaccccacttctccacatttaattgtgtgagctccagccactaggctac |
29646501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 127 - 241
Target Start/End: Original strand, 32616385 - 32616501
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaa |
224 |
Q |
| |
|
|||||| || |||||||||||||||| | ||||| ||||||||||| || | |||||||| ||||||||||||||||||| ||||| | |||||||| |
|
|
| T |
32616385 |
tgtgagctttgctcagttggtagggacaaatgcattttatatgcaggggctggggttcgaatcccggacaccccacttctctgcatttaaaatgtgtgag |
32616484 |
T |
 |
| Q |
225 |
ctctagccactaggcta |
241 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
32616485 |
ctccagccactaggcta |
32616501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 128 - 235
Target Start/End: Complemental strand, 3299034 - 3298927
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||| ||||||||| | || |||||||| || ||| |||||||||||| ||||| |||||||| ||| |
|
|
| T |
3299034 |
gtgagcttagatcaattggtagggatattgcatataatatgcaggggtcggaattcgaacctcgaacatcccacttctccatatttaaatgtgtgagctc |
3298935 |
T |
 |
| Q |
228 |
tagccact |
235 |
Q |
| |
|
|| ||||| |
|
|
| T |
3298934 |
taaccact |
3298927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 128 - 187
Target Start/End: Complemental strand, 4869765 - 4869706
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaac |
187 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
4869765 |
gtgagcttagctcagttggtagggatactgcatattatatgcaggggccggggttcgaac |
4869706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 16268209 - 16268088
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatg |
218 |
Q |
| |
|
|||||| | ||||| ||| ||| ||||||||| ||||||||| ||||||||||| |||| ||||||||||||||| || ||||||||||| | ||| || |
|
|
| T |
16268209 |
tttatctccgtgagcttaactcggttggtagg-atattgcattttatatgcaggggccggggttcgaaccccggatactccacttctccagaattaaat- |
16268112 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||||||| ||| |||| |
|
|
| T |
16268111 |
tgtgagctctagccaatagactac |
16268088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 8443542 - 8443656
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| |||||||| ||| | ||| |||| | |||||||| | | |||| ||||||||||||||||||||||||||||||| | ||||| ||| |
|
|
| T |
8443542 |
gtgagtttaactcagttgacaggaacattacataatttatgcaggggtcatggttagaaccccggacaccccacttctccacatttaattctgtgagctc |
8443641 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
8443642 |
tagtcactaggctac |
8443656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 8452346 - 8452460
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| |||||||| ||| | ||| |||| | |||||||| | | |||| ||||||||||||||||||||||||||||||| | ||||| ||| |
|
|
| T |
8452346 |
gtgagtttaactcagttgacaggaacattacataatttatgcaggggtcatggttagaaccccggacaccccacttctccacatttaattctgtgagctc |
8452445 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
8452446 |
tagtcactaggctac |
8452460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 26347413 - 26347522
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| || ||| |||| |||||| ||||| |||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
26347413 |
ttagctcagttggtagagatattgtatattatatgttgggctcgatgttcaaaccccagacactccacttctccacaatttaattgtgtgagctctagcc |
26347512 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
26347513 |
actagactac |
26347522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 28021226 - 28021350
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgag-----gttcgaaccccggacaccccacttctccacatttat-a |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||| | ||| || | || | | |||||||||| | ||||||||||||||||||||||| | |
|
|
| T |
28021226 |
tccccgtgagtttagctcagttggtagggacattgcataatttatacaagggcagtgcaggggttcgaaccctg-acaccccacttctccacatttataa |
28021324 |
T |
 |
| Q |
217 |
tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||| |||||||||||||| |
|
|
| T |
28021325 |
tgtgtgagctccagccactaggctac |
28021350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 237
Target Start/End: Original strand, 29733637 - 29733742
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggag-ccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagc |
231 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| | ||| |||||||| | |||||||| ||||||||| || ||| | ||||||| || |||| |
|
|
| T |
29733637 |
ttagctcagttggtacggatattacatattatatgcaggggcccggggttcgaaacgcggacacctcacttctccgcaattaaattgtgtgagctttagc |
29733736 |
T |
 |
| Q |
232 |
cactag |
237 |
Q |
| |
|
|||||| |
|
|
| T |
29733737 |
cactag |
29733742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 237
Target Start/End: Complemental strand, 32142098 - 32141993
Alignment:
| Q |
134 |
ttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagc |
231 |
Q |
| |
|
||||||||||||||||||| | ||||| ||||||| ||| || | |||||||||||| |||||||||||| ||||||||| | |||||||| ||| ||| |
|
|
| T |
32142098 |
ttagctcagttggtagggacaaatgcattttatatgtaggggctggggttcgaaccccagacaccccacttttccacatttaaaatgtgtgagctccagc |
32141999 |
T |
 |
| Q |
232 |
cactag |
237 |
Q |
| |
|
|||||| |
|
|
| T |
32141998 |
cactag |
32141993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 32412369 - 32412264
Alignment:
| Q |
139 |
tcagttggtagggatattgcatattatatgcaggagccgag-gttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | | ||||||| ||||||||| ||||||||||||| ||| | ||||||| || ||| ||||| |
|
|
| T |
32412369 |
tcagttggtagggatattgcatattatatgcagggggctggagttcgaatcccggacactccacttctccacaattaaattgtgtgagctttaggcacta |
32412270 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
||||| |
|
|
| T |
32412269 |
tgctac |
32412264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 33697186 - 33697069
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| ||| |||||||| |||||||||||||| ||||||||||| | || ||||||| ||||||||| |||||| |||||| ||| | | | |
|
|
| T |
33697186 |
atccccgtgagcttaactcagttgatagggatattgcattttatatgcaggggtcggagttcgaatcccggacactccacttttccacaattaaattata |
33697087 |
T |
 |
| Q |
221 |
tgaactctagccactagg |
238 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
33697086 |
tgagctctagccactagg |
33697069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 1100300 - 1100224
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| || || ||||||||||| |||| ||||||||||||| |
|
|
| T |
1100300 |
ttagctcagttggtagggatatagcattttatatgcagtagtcggtgttcgaaccccatacactccacttctccaca |
1100224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 183
Target Start/End: Complemental strand, 10501199 - 10501151
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcatattatatgcaggagccgaggttc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
10501199 |
tagctcagttggtagggatattgcatattatatgcaggggtcgaggttc |
10501151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 238
Target Start/End: Complemental strand, 32620128 - 32620028
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||| || ||| |||||||| | |||||||||| | |||||||| || |||||||||| ||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
32620128 |
ctcagttgatatggacattgcataatttatgcaggagttggggttcgaatcctggacaccccatttctccacatttaattgtatgagctctagccactag |
32620029 |
T |
 |
| Q |
238 |
g |
238 |
Q |
| |
|
| |
|
|
| T |
32620028 |
g |
32620028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 156 - 242
Target Start/End: Original strand, 3709890 - 3709977
Alignment:
| Q |
156 |
tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| | | | |||||||||||| |||||||||||||||||||||| | ||||| || ||| |||||||||||||| |
|
|
| T |
3709890 |
tgcatattatatgcaaggggtggggttcgaaccccagacaccccacttctccacatttaaaatgtgagagctccagccactaggctac |
3709977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 7414332 - 7414442
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||| | ||| ||||||||| | ||| ||||||||||| ||||| ||||||| || |
|
|
| T |
7414332 |
gtgagcttggctcagttggtagggatattgcatattatatgcaagggccagggttcgaactctgga-----cacttctccacaatttaattgtgtgagct |
7414426 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7414427 |
atagccactaggctac |
7414442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 195
Target Start/End: Original strand, 21203041 - 21203108
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggaca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| | |||| | ||||||||||||||| |
|
|
| T |
21203041 |
gtgagtttagctcagttggtagggatattgcatatcatatgaaacggccgggattcgaaccccggaca |
21203108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 143 - 233
Target Start/End: Original strand, 30916339 - 30916430
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||||||||| |||||||| || | | ||||||||||| |||||| ||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
30916339 |
ttggtagggatattgcatgttatatgcgggggttggggttcgaaccctggacactccacttctccacaattaaattgtgtgagctctagcca |
30916430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 128 - 203
Target Start/End: Original strand, 30938391 - 30938466
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| ||| ||||||||||||||| |||||||| |||||||||| ||| |||||||||||| ||||||| |||| |
|
|
| T |
30938391 |
gtgagcttaactcagttggtagggacattgcataatatatgcagggaccggggttcgaaccccagacaccctactt |
30938466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 32283536 - 32283627
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||| | |||||| | | || |||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
32283536 |
tccctgtgagcttagctcaattggtagggacattgcataatttatgcaagggtcggggttcgaaccccagacacttcacttttccacattta |
32283627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 141 - 234
Target Start/End: Original strand, 5944442 - 5944536
Alignment:
| Q |
141 |
agttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccac |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | || ||||| ||| || ||||||| | |||||||| ||| | ||||||||||||| |||| |
|
|
| T |
5944442 |
agttggtagggatattgcatattatatgcaggggtcggggttcaaactccagacaccctatttctccacaattaagttgtgtgaactctaaccac |
5944536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 122 - 172
Target Start/End: Complemental strand, 27094880 - 27094830
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27094880 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
27094830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 191 - 241
Target Start/End: Complemental strand, 31956182 - 31956132
Alignment:
| Q |
191 |
ggacaccccacttctccacatttatatgtgtgaactctagccactaggcta |
241 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
31956182 |
ggacaccccacttcttcacattaatatgtgtgagctctagccactaggcta |
31956132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 2688640 - 2688563
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac-cccacttctccaca |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||| || | ||||||||||||||||| ||||||||||||| |
|
|
| T |
2688640 |
ttagctcagttggtaaggatattgcatattatatacagaggctggagttcgaaccccggacacttccacttctccaca |
2688563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 9064872 - 9064941
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
9064872 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccactt |
9064941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 14981791 - 14981722
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
14981791 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccactt |
14981722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 150 - 242
Target Start/End: Complemental strand, 15449608 - 15449515
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||| |||||||||| || |||||||||| |||||| ||||||||||||| | | | ||||||| ||||| | |||||||||| |
|
|
| T |
15449608 |
ggatattgcatattgtatgcaggagacggggttcgaaccttggacactccacttctccacaatgaaattgtgtgagctctaactactaggctac |
15449515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 17751398 - 17751357
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17751398 |
ttatatgcaggagcagaggttcgaaccccggacaccccactt |
17751357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 203
Target Start/End: Complemental strand, 19680309 - 19680268
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19680309 |
ttatatgcaggagccggggttcgaaccccggacaccccactt |
19680268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 20728964 - 20729069
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||| |||| |||||||||||||||||| | | |||| |||||||| | |||||| ||||||| ||| ||||| ||||||| |||||||||||| |
|
|
| T |
20728964 |
ctcagttagtagagatattgcatattatatgtaagggccggggttcgaattctggacactccacttcctcacaatttaattgtgtgagctctagccacta |
20729063 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
20729064 |
ggctac |
20729069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 29070843 - 29070723
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||| || |||||||||||| ||||||||||| | |||||| ||||||||||||| ||| | ||| |
|
|
| T |
29070843 |
atccatgtgagtctagctcagttgatagggatattatattttatatgcagga-tcgaggttcgaatctgggacactccacttctccacaattaaattgta |
29070745 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||| | ||||||||||| |
|
|
| T |
29070744 |
tgagctctggtcactaggctac |
29070723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 29103416 - 29103296
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||| || |||||||||||| ||||||||||| | |||||| ||||||||||||| ||| | ||| |
|
|
| T |
29103416 |
atccatgtgagtctagctcagttgatagggatattatattttatatgcagga-tcgaggttcgaatctgggacactccacttctccacaattaaattgta |
29103318 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||| | ||||||||||| |
|
|
| T |
29103317 |
tgagctctggtcactaggctac |
29103296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 125 - 242
Target Start/End: Original strand, 7771287 - 7771408
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta----tatgtg |
220 |
Q |
| |
|
|||||||| |||||||||||| ||||| |||||||| | |||||||| | | ||||| || |||||| ||| | |||||||||||||| ||| || |
|
|
| T |
7771287 |
cctgtgagcttagctcagttgacagggacattgcataatttatgcaggggtcagggttcaaatcccggatacctcgcttctccacatttaattgtatatg |
7771386 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
7771387 |
tgagctctagccactaggctac |
7771408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 13436553 - 13436633
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||| |||||| ||||||| |||||||| |||||||||| || ||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
13436553 |
ttagttcagttagtagggacattgcataatatatgcaggggcaatggttcaaacccctgacaccccacttctccatattta |
13436633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 212
Target Start/End: Original strand, 13656269 - 13656353
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatt |
212 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||| |||||||||| | ||| ||| ||||||| |||||||||||||| |||||| |
|
|
| T |
13656269 |
tgagcttagctcagttggtagggacaaatgcataatatatgcaggggtcgatgtttgaaccccagacaccccacttcttcacatt |
13656353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 14579359 - 14579307
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
174 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
14579359 |
atccccgtgagtttagcttatttggtagggatattgcaaattatatgcaggag |
14579307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 150 - 233
Target Start/End: Original strand, 33140431 - 33140516
Alignment:
| Q |
150 |
ggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt---atatgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||||| ||||||| |||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
33140431 |
ggatattgcatgttatatgcagg-gctgaggttcgaactccggacatcccacttctctgcatttaaaatatgtgtgagctctagcca |
33140516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 6228355 - 6228280
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| |||| | ||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
6228355 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccactt |
6228280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 214
Target Start/End: Complemental strand, 12882067 - 12882012
Alignment:
| Q |
159 |
atattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||| || | |||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12882067 |
atattatattcatgggccggggttcgaaccccggacaccccacttttccacattta |
12882012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 22983612 - 22983655
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
22983612 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
22983655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 23804796 - 23804753
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
23804796 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
23804753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 24256948 - 24256991
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
24256948 |
tattatatgcaggggccgaggttcgaaccccggataccccactt |
24256991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 208
Target Start/End: Complemental strand, 30700257 - 30700178
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||||||||||||| || ||| ||| |||| || |||||||||||| |
|
|
| T |
30700257 |
tgagcttaactcagttggtacggatattgcatattatatgcaggagtcggagtttgaatcccgaacgtcccacttctcca |
30700178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 389337 - 389418
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| ||| ||||||||||| ||||||| ||| ||||||||||| | || ||||||||||||||||| |||||| |||||| |
|
|
| T |
389337 |
gtgagcttaactcagttggtatggatatttcat-ttatatgcaggggtcggagttcgaaccccggacactccacttatccaca |
389418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 134 - 172
Target Start/End: Complemental strand, 4089988 - 4089950
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4089988 |
ttagctcagtcggtagggatattgcatattatatgcagg |
4089950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 242
Target Start/End: Complemental strand, 25020591 - 25020511
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||| | ||| ||||| | ||||| ||||||||||||||||| |
|
|
| T |
25020591 |
tattatatgcaggggcctgggttcgaaccccggacaccccacttattcac-cttataag-gtgaattctagccactaggctac |
25020511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 144 - 186
Target Start/End: Complemental strand, 31789618 - 31789576
Alignment:
| Q |
144 |
tggtagggatattgcatattatatgcaggagccgaggttcgaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31789618 |
tggtagggatattgcatattatatgcaggagccggagttcgaa |
31789576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 12089104 - 12089172
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||| | | ||||| |||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
12089104 |
tagctcagttggtagg-acaatgcattattatatgcaggggccggagttcgaaccccggacaccccactt |
12089172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 146 - 207
Target Start/End: Complemental strand, 16719368 - 16719308
Alignment:
| Q |
146 |
gtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||| | | |||||||||||||| | || |||||||||| |
|
|
| T |
16719368 |
gtagggatattgcatattatatgcagg-ggcaaggttcgaaccccgaatactccacttctcc |
16719308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 197
Target Start/End: Complemental strand, 30639487 - 30639418
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| |||||||| | | |||||||||| | |||||||| |
|
|
| T |
30639487 |
gtgagtttagctcagttggtaggaataatgcataatatatgcaaggtctgaggttcgaatctcggacacc |
30639418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 236
Target Start/End: Complemental strand, 34574170 - 34574113
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||| |||||||| || ||| ||||| |
|
|
| T |
34574170 |
ggttcaaaccccgaacaccccacttctccacatttaaatgtgtgagctgtagtcacta |
34574113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 214
Target Start/End: Complemental strand, 35038732 - 35038683
Alignment:
| Q |
165 |
tatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
35038732 |
tatgcaggggccggggttcgaaccccggacaccccatttctctacattta |
35038683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 203
Target Start/End: Complemental strand, 10377219 - 10377144
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| |||||||||||||||| | | ||||| ||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
10377219 |
gtgagtatagctcagttggtagg-acaatgcattattatatgcagaggccggggttcgaaccccgaacaccccactt |
10377144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 18071562 - 18071642
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcca |
233 |
Q |
| |
|
||||||||||||| ||| | |||||||| ||||||| ||||||||||| ||| |||| ||| | ||||||| ||||||||| |
|
|
| T |
18071562 |
attgcatattataggcaagggccgaggtacgaaccctggacaccccacctcttcacaattaaattgtgtgagctctagcca |
18071642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Original strand, 2970221 - 2970264
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2970221 |
tattatatgtaggggccgaggttcaaaccccggacaccccactt |
2970264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 242
Target Start/End: Complemental strand, 3012770 - 3012675
Alignment:
| Q |
148 |
agggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||| || ||||||||| ||| |||||||| ||||| ||||||| ||||||||| ||| |||| |
|
|
| T |
3012770 |
agggatattgcattttatatgcaggggctagggttcaaatcccggacactccatttctccacaatttaattgtgtgagctctagccattagactac |
3012675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 203
Target Start/End: Original strand, 3448340 - 3448427
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||| |||| ||||| ||||||| |||| ||||| | ||||| ||||| ||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
3448340 |
aatttgtccccgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccactt |
3448427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 9491798 - 9491755
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
9491798 |
tattatatgtaggggccggggttcgaaccccggacaccccactt |
9491755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 190
Target Start/End: Original strand, 13698598 - 13698657
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacccc |
190 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||||||||||||||| || | |||||||||| |
|
|
| T |
13698598 |
agtttagctcaattgatagagatattgcatattatatgcaggaaccaggattcgaacccc |
13698657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 233
Target Start/End: Complemental strand, 15305177 - 15305066
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgt |
221 |
Q |
| |
|
||||| ||||||||| ||||||||||||| | |||||||| | |||||||| | | ||||||||| || |||| ||| ||||||||| ||| | ||| |
|
|
| T |
15305177 |
atccccgtgagtttaactcagttggtaggaacattgcataatttatgcaggtgttggggttcgaactccaaacactccatttctccacaattaattatgt |
15305078 |
T |
 |
| Q |
222 |
gaactctagcca |
233 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
15305077 |
gagctctagcca |
15305066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 203
Target Start/End: Complemental strand, 20415657 - 20415582
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| || ||| |||||| |||| | ||| |||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
20415657 |
tgagtttagctcattttgtaagggataatgcacaatatgtgcaggggccagggttcgaaccccggacaccccactt |
20415582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 210
Target Start/End: Original strand, 31952323 - 31952354
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31952323 |
ggttcgaaccccggacaccccacttctccaca |
31952354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 168
Target Start/End: Original strand, 21248541 - 21248575
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21248541 |
ttagctcagttggtagggatattgcattttatatg |
21248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 242
Target Start/End: Original strand, 28842687 - 28842772
Alignment:
| Q |
157 |
gcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatat-gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||| || | |||| ||||||| ||||| |||||| |||||| ||| || |||||| |||||||||||||||||| |
|
|
| T |
28842687 |
gcattttatatgcaggggctggggttggaaccccagacactccactt-tccacaattaaattgtgtgagctctagccactaggctac |
28842772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 34181575 - 34181489
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||| |||||||| || |||||||||||||||||| || || | | ||||||||||| |||||| | |||| |||||||| |
|
|
| T |
34181575 |
gtgagtttaactcagttgataacgatattgcatattatatgtagaaggcaggattcgaaccccgaacaccctatttcttcacattta |
34181489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #173
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 12078 - 12029
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
|||||| |||||||||||||||||| ||| |||| |||||| |||||||| |
|
|
| T |
12078 |
tatccccgtgagtttagctcagttgatagagataatgcataatatatgca |
12029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #174
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 1368249 - 1368168
Alignment:
| Q |
134 |
ttagctcagttggtagggatat-tgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||||||| | |||| | |||||||||| || ||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
1368249 |
ttagctcagttggtagggacaaatgcacaatatatgcaggggctagggttcaaactccagacaccccacttctccacattta |
1368168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #175
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 235
Target Start/End: Original strand, 4326213 - 4326327
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt---atatgt |
219 |
Q |
| |
|
|||| ||||| ||| | ||||||| |||||||||||||| |||||| ||| | | |||||||||||| | |||||||||| || |||||| | |||| |
|
|
| T |
4326213 |
tccccgtgagcttaacccagttggaagggatattgcataatatatgtaggggttg-ggttcgaaccccagccaccccacttttcaacatttaaaaaatgt |
4326311 |
T |
 |
| Q |
220 |
gtgaactctagccact |
235 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
4326312 |
gtgagctctagccact |
4326327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 6143971 - 6144039
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||| ||| | || ||||||||||||||||||||||||| |
|
|
| T |
6143971 |
tagctcagttggcagggacaatgcattattatatgtaggggtcg-ggttcgaaccccggacaccccactt |
6144039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #177
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 199
Target Start/End: Original strand, 10455776 - 10455813
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacacccc |
199 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
10455776 |
ttatatgcaggggccggggttcgaaccccggacacccc |
10455813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #178
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 26669747 - 26669679
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||||| ||| || | |||||||||||| |||||||||||| |
|
|
| T |
26669747 |
tagctcagttggtagggacat-gcataattatatgtaggggctggggttcgaaccccagacaccccactt |
26669679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #179
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 30833051 - 30833092
Alignment:
| Q |
162 |
ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
30833051 |
ttatatgcaggggtcggggttcgaaccccggacaccccactt |
30833092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 3338403 - 3338316
Alignment:
| Q |
127 |
tgtgagtttagctcagttggtagg-gatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
||||||||||||||| |||||| | |||| |||||||| | |||||| || || ||||||||||| ||||||| |||| | |||||||| |
|
|
| T |
3338403 |
tgtgagtttagctcacttggtaagagataatgcatatttt-tgcaggggctgaagttcgaaccccagacaccctacttattcacattta |
3338316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #181
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 4854362 - 4854326
Alignment:
| Q |
167 |
tgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
4854362 |
tgcaggggccggggttcgaaccccggacaccccactt |
4854326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #182
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 172
Target Start/End: Original strand, 7425381 - 7425425
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
|||||||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
7425381 |
gtgagtttgactcagtttgtagggatattccatattatatgcagg |
7425425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #183
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 166
Target Start/End: Complemental strand, 7470790 - 7470758
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattata |
166 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
7470790 |
ttagctcagttggtagggataatgcatattata |
7470758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #184
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 9689319 - 9689275
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttatatgtgtga |
223 |
Q |
| |
|
||||||||||| |||||||||||| ||||| ||||| |||||||| |
|
|
| T |
9689319 |
ggttcgaaccctggacaccccactcctccatatttaaatgtgtga |
9689275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #185
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 18903423 - 18903387
Alignment:
| Q |
167 |
tgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
18903423 |
tgcaggggccggggttcgaaccccggacaccccactt |
18903387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #186
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 168
Target Start/End: Original strand, 32837345 - 32837385
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatg |
168 |
Q |
| |
|
||||| |||||||||||| |||||||||| ||||||||||| |
|
|
| T |
32837345 |
gtgagcttagctcagttgctagggatattacatattatatg |
32837385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 59779 - 59901
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||| |
|
|
| T |
59779 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgt |
59878 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| ||||||||||||| |||| |
|
|
| T |
59879 |
gtgagctctagccactagactac |
59901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 208
Target Start/End: Original strand, 83628 - 83708
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||| || |||||| |||| |
|
|
| T |
83628 |
gtgagtttagctcagttatttgggatattgcatattatatgcaggagctgaggttcgaaccccggatactccacttttcca |
83708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 17617 - 17738
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||| | |||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccacaattaaattgtg |
17716 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
17717 |
tgagctctagccactaggctac |
17738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 927 - 812
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | |||| || || |
|
|
| T |
927 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgcgagct |
828 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
827 |
ctagccactaggctac |
812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 8963 - 9084
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||| ||| | |||| |
|
|
| T |
8963 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggatactccacttctccacaattaaattgtg |
9062 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
9063 |
tgagctctagccactaggctac |
9084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 242
Target Start/End: Complemental strand, 4087 - 3966
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtg |
220 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
4087 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttctccacaatttaattgtg |
3988 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
3987 |
tgagctctagccactaggctac |
3966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 11181 - 11072
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
11181 |
ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagcc |
11082 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
| |||||||| |
|
|
| T |
11081 |
attaggctac |
11072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 21509 - 21400
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| | ||||||| |||||||| |
|
|
| T |
21509 |
ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtgtgagctctagcc |
21410 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
| |||||||| |
|
|
| T |
21409 |
attaggctac |
21400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 12003 - 12112
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
12003 |
ttagctcagttggtagggatattgcatattatatgcaggagccggggtttgaaccccggacactccacttctccacaattaaattgtgtgaactctagcc |
12102 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
12103 |
actagactac |
12112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 121 - 242
Target Start/End: Original strand, 46522 - 46644
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgt |
219 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||| || | |||||||||||| ||||| ||||| |||||| ||||| ||| |
|
|
| T |
46522 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccactgctccacaatttaattgt |
46621 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
46622 |
gtgaactctggccactaggctac |
46644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 208
Target Start/End: Complemental strand, 2566 - 2487
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcca |
208 |
Q |
| |
|
||||| |||||||| ||| ||||||||| |||| ||||||||||| | || ||||||||| || ||||| ||||||||||| |
|
|
| T |
2566 |
gtgagcttagctcaattgttagggatatcgcattttatatgcaggggtcg-ggttcgaacacctgacactccacttctcca |
2487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 119 - 210
Target Start/End: Complemental strand, 96 - 5
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
96 |
tttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccaca |
5 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 3669 - 3784
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| ||| | ||||||| || |
|
|
| T |
3669 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggaaccagggttcgaaccccggacactccacttctccacaattaaattgtgtgagct |
3768 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3769 |
ctagccactaggctac |
3784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 120 - 242
Target Start/End: Original strand, 112103 - 112226
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tg |
218 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||| | |||| || ||||||||||||| ||| | || |
|
|
| T |
112103 |
ttatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggtttgaatctcggatactccacttctccacaattaaattg |
112202 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
112203 |
tgtgagctctagccactaggctac |
112226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 12456 - 12577
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtg |
220 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||| ||||||||||||| ||| | |||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacattccacttctccacaattaaattgtg |
12555 |
T |
 |
| Q |
221 |
tgaactctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
12556 |
tgagctctagccactaggctac |
12577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 125 - 207
Target Start/End: Complemental strand, 13273 - 13192
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc |
207 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||| ||||||||||| |
|
|
| T |
13273 |
cctgtgcgcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccggaca-cccacttctcc |
13192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 128 - 233
Target Start/End: Original strand, 15767 - 15873
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
15767 |
gtgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccacaattaaattgtgtgagct |
15866 |
T |
 |
| Q |
227 |
ctagcca |
233 |
Q |
| |
|
||||||| |
|
|
| T |
15867 |
ctagcca |
15873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 24392 - 24497
Alignment:
| Q |
137 |
gctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||| |||| |||||||||||||| | |||||||| |||| |||||||||||||||||| |||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
24392 |
gctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttcacatttaaatgtgtgagctctagccacta |
24491 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
24492 |
ggctac |
24497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 27997 - 27882
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||| ||||||||||| |||| ||||||| |||||||||| ||||||||||||| ||| | ||||||| | |
|
|
| T |
27997 |
gtgagcttagctcggttggtagggatattgcattttatatgcaggggccggggttcgatccccggacactccacttctccacaattaaattgtgtgagtt |
27898 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27897 |
ctagccactaggctac |
27882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 236
Target Start/End: Original strand, 315658 - 315761
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||| | ||| |||||||||||||||| ||||||||||||||||| | |||||||||||||| || |
|
|
| T |
315658 |
ttagctcagttggtaaggatattgcattttatatgcaggggtcgatgttcgaaccccggacatcccacttctccacatttaaaatgtgtgaactctaacc |
315757 |
T |
 |
| Q |
233 |
acta |
236 |
Q |
| |
|
|||| |
|
|
| T |
315758 |
acta |
315761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 304101 - 304037
Alignment:
| Q |
179 |
ggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||||||||||||| |||| | ||| | |||||||| |||||||||||| |||| |
|
|
| T |
304101 |
ggttcgaacctcggacaccccacttttccataattaaattgtgtgaattctagccactagactac |
304037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 134 - 203
Target Start/End: Original strand, 1873 - 1942
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1873 |
ttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccactt |
1942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 121 - 241
Target Start/End: Complemental strand, 236429 - 236311
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtg |
220 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||||||||||||| ||||| | || ||||||||||||||||||||||||| |||||||| | ||||| |
|
|
| T |
236429 |
tatccccgtgagattagttcagttggtagggatattgcatattat--gcaggggtcggggttcgaaccccggacaccccacttatccacattaaaatgtg |
236332 |
T |
 |
| Q |
221 |
tgaactctagccactaggcta |
241 |
Q |
| |
|
||| || || ||||||||||| |
|
|
| T |
236331 |
tgagctttaaccactaggcta |
236311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 120 - 240
Target Start/End: Complemental strand, 8900 - 8779
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||| |||||||| |||| || | ||||||||||||| ||| |||||||| ||||| || |
|
|
| T |
8900 |
ttatccccgtgagcttagctcagttggtagggatattgcatattttatgcaggggccgggggttgaaccccggacactccatttctccacaatttaattg |
8801 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggct |
240 |
Q |
| |
|
||| | |||||||||||||||| |
|
|
| T |
8800 |
tgtcagctctagccactaggct |
8779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 147 - 242
Target Start/End: Complemental strand, 18527 - 18431
Alignment:
| Q |
147 |
tagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||| ||| | ||||||| ||||||||| |||||||| |
|
|
| T |
18527 |
tagggatattgcatattatatacaggggccggggttcgaaccccggacaccccacttctccacaattaaattgtgtgagctctagccattaggctac |
18431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 138 - 236
Target Start/End: Original strand, 6781 - 6880
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccacta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||| ||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
6781 |
ctcagttggtagggatattgcatattatatgtaggagtcgaggttcgaaccccaaacatcccacttctccacaatttaactgtgtgagctctagccacta |
6880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 121 - 242
Target Start/End: Complemental strand, 17335 - 17213
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||| ||| |||||||| |||||||||||||| ||| ||||||| |||| |||||||||||||||||| |||||||| |||| ||| | ||| |
|
|
| T |
17335 |
tatccccgtgaacttaactcagttgatagggatattgcattttacatgcaggggccggggttcgaaccccggacactccacttcttcacaattaaattgt |
17236 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
17235 |
gtgagctctagccactaggctac |
17213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 120 - 201
Target Start/End: Complemental strand, 266772 - 266691
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| ||||| |||| |
|
|
| T |
266772 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaacccagacactccac |
266691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 41714 - 41606
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| |||||||| |||| ||||| |||||||| | |||||||| ||||||||||||||||||||||||||||||| |||| |||||||| ||| |
|
|
| T |
41714 |
gtgagcttagctcaattggcagggacattgcataatttatgcagg------ggttcgaaccccggacaccccacttctccacgtttaaatgtgtgagctc |
41621 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
41620 |
tagccactaagctac |
41606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 108424 - 108381
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
108424 |
tattatatgcaggggctgaggttcaaaccccggacaccccactt |
108381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 396 - 512
Alignment:
| Q |
121 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgt |
219 |
Q |
| |
|
|||||| |||| |||||||| ||| |||||||||||||||||||||||||| |||| |||||||||| ||||||| ||||||||| ||| ||| | ||| |
|
|
| T |
396 |
tatccccgtgaacttagctcaattgatagggatattgcatattatatgcaggggccggggttcgaacctcggacactccacttctctacaattaaattgt |
495 |
T |
 |
| Q |
220 |
gtgaactctagccacta |
236 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
496 |
gtgaactctaaccacta |
512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 28882 - 28778
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||||||||| |||||| ||| |||| | |||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
28882 |
ttagctcagttgatagggacattacatactttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaattgtgtgagctccagcca |
28783 |
T |
 |
| Q |
234 |
ctagg |
238 |
Q |
| |
|
|||| |
|
|
| T |
28782 |
ttagg |
28778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 242
Target Start/End: Complemental strand, 1795 - 1673
Alignment:
| Q |
126 |
ctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac------atttatatgt |
219 |
Q |
| |
|
||||||| ||| ||||| | ||||||||||| ||||||||||| | | | | |||||||||||||||||| |||||||||||| ||||| ||| |
|
|
| T |
1795 |
ctgtgagcttaactcagctagtagggatattacatattatatgtaagggttggggttcgaaccccggacactccacttctccacaattaaatttaattgt |
1696 |
T |
 |
| Q |
220 |
gtgaactctagccactaggctac |
242 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
1695 |
gtgatctctagccactaggctac |
1673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 21267 - 21382
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctcc-acatttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||| | | | |||||||||| |||| |||||||||| | |||||| ||||||| || |
|
|
| T |
21267 |
gtgagcttagcttagttggtagggatattgcatattatatgcaggggttgggtttcgaaccccagacattccacttctccaaaatttatttgtgtgagct |
21366 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
21367 |
ctagccactaggctac |
21382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 120 - 242
Target Start/End: Complemental strand, 65862 - 65739
Alignment:
| Q |
120 |
ttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatg |
218 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||| ||| | | |||||||| ||||||||| |||||||| ||| ||||| || |
|
|
| T |
65862 |
ttattcctgtgagcttagctcagttggtagggatattgcatattatatgtaggggttggggttcgaatcccggacactccacttcttcacaatttaattg |
65763 |
T |
 |
| Q |
219 |
tgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||| ||||| ||||||||||| |
|
|
| T |
65762 |
tgtgagctctaatcactaggctac |
65739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0999 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0999
Description:
Target: scaffold0999; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 2178 - 2292
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||||||| || | |||||||||||||| |||| ||||| || ||| | ||||| | ||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
2178 |
gtgagtttaacttaattggtagggatattacataatatatacatgagttggggttcaatccccggacacctcacttctccacatttaaatgtgtgaactc |
2277 |
T |
 |
| Q |
228 |
tagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
2278 |
tagccactagactac |
2292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 117 - 242
Target Start/End: Original strand, 8813 - 8938
Alignment:
| Q |
117 |
aatttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata |
216 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||||||| ||||||||||| | || ||||||||||||| ||| ||| ||||||||| ||| | |
|
|
| T |
8813 |
aattaatccccgtgagcttagctcagttggtagggatattgcattttatatgcagg-gtcggggttcgaaccccgaacaatccatttctccacaattaaa |
8911 |
T |
 |
| Q |
217 |
-tgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||| ||||||||| |||||||| |
|
|
| T |
8912 |
ttgtgtgagctctagccattaggctac |
8938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 125 - 241
Target Start/End: Original strand, 1260 - 1377
Alignment:
| Q |
125 |
cctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtga |
223 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||||||||| ||||||| ||| |||| ||||| |||| ||||||| |||||||||||| ||||| | ||||| |
|
|
| T |
1260 |
cctgtgagcttagctcagctggtaggaatattgcattttatatgtaggggccggggttcaaacctcggacactccacttctccacaatttaattatgtga |
1359 |
T |
 |
| Q |
224 |
actctagccactaggcta |
241 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1360 |
gctctagccactaggcta |
1377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 23374 - 23478
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccacta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||||||| | ||| | ||||||| ||||| |||||| |
|
|
| T |
23374 |
ctcagttggtagggatattgcatattatatgcagaggccggggttcgaa-cccggacactccacttctccataattaaattgtgtgagctctaaccacta |
23472 |
T |
 |
| Q |
237 |
ggctac |
242 |
Q |
| |
|
|||||| |
|
|
| T |
23473 |
ggctac |
23478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 210
Target Start/End: Complemental strand, 37490 - 37398
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgagg-ttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| || || |||||| |||||| ||||||||||||| |
|
|
| T |
37490 |
tttatcctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggatttgaaccctggacactccacttctccaca |
37398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 233
Target Start/End: Complemental strand, 3028 - 2924
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactct |
228 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||| | |||||||| |||| |||||||||||||||||||||||||||| ||| ||| ||||||| |||| |
|
|
| T |
3028 |
tgagcttagctcagttgaaagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctcgacaattaattgtgtgagctct |
2929 |
T |
 |
| Q |
229 |
agcca |
233 |
Q |
| |
|
||||| |
|
|
| T |
2928 |
agcca |
2924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 1265 - 1380
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||| |||||| |||||||||||||||| ||||||||| |||||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
1265 |
gtgagcttaactcagttggtaggaatattgtatattatatgcaggagttaaggttcgaatcccggatactccacttctccacaattaaattgtgtgagct |
1364 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
1365 |
ctagccactaagctac |
1380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 1320 - 1435
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| ||||||||||||| |||||| |||||||||||||||| ||||||||| |||||| || ||||||||||||| ||| | ||||||| || |
|
|
| T |
1320 |
gtgagcttaactcagttggtaggaatattgtatattatatgcaggagttaaggttcgaatcccggatactccacttctccacaattaaattgtgtgagct |
1419 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
1420 |
ctagccactaagctac |
1435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 15008 - 15117
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactc |
227 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| | |||||||| | | |||||||||||| |||||||||||||||||||||| | ||||| ||| |
|
|
| T |
15008 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggggtcatggttcgaaccccaaacaccccacttctccacatttaattatgtgagctc |
15107 |
T |
 |
| Q |
228 |
tagccactag |
237 |
Q |
| |
|
|||| ||||| |
|
|
| T |
15108 |
tagctactag |
15117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 12328 - 12213
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||| | | || ||| |||| ||| |||||||||||| ||| | ||||||| || |
|
|
| T |
12328 |
gtgagcttagctcagttggtagggatattgcatattatatgcatgaggtgggatttgaaacccgcacatttcacttctccacaattaaattgtgtgagct |
12229 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12228 |
ctagccactaggctac |
12213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 210
Target Start/End: Original strand, 175 - 256
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||| |||| |||||||||||| |||| |||||||||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaaccccaaacacttcacttctccaca |
256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 146 - 65
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||| |||| |||||||||||| |||| |||||||||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaaccccaaacacttcacttctccaca |
65 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0257 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 133 - 242
Target Start/End: Original strand, 21802 - 21911
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcc |
232 |
Q |
| |
|
||||||||||||| |||| | |||| ||| | |||||||| |||| || ||||| ||||||||||||| ||||||||||||| | ||||| ||||||| |
|
|
| T |
21802 |
tttagctcagttgataggcacattgtataatttatgcaggggccggggatcgaatcccggacaccccaattctccacatttaattttgtgagttctagcc |
21901 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
21902 |
actaggctac |
21911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 236
Target Start/End: Original strand, 45919 - 46022
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagcc |
232 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||| | || ||||||| |||| ||||| |||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
45919 |
ttagctcagttggtagagatattatatattatatgcaggggtcggggttcgagccccagacactccacttctccacaatttaattgtgtgagttctagcc |
46018 |
T |
 |
| Q |
233 |
acta |
236 |
Q |
| |
|
|||| |
|
|
| T |
46019 |
acta |
46022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 56326 - 56441
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaact |
226 |
Q |
| |
|
||||| ||| |||| |||| ||||||||||||||||||||||||| |||| |||||||||||| ||||| || ||||||||| ||| | ||||||| | |
|
|
| T |
56326 |
gtgagcttaactcaattggcagggatattgcatattatatgcaggggccggggttcgaaccccagacacttcatttctccacaattaaattgtgtgagtt |
56425 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
56426 |
ttagccactagactac |
56441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 2446 - 2394
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattatatgcaggag |
174 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
2394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0264 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0264
Description:
Target: scaffold0264; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 242
Target Start/End: Original strand, 20286 - 20394
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagcca |
233 |
Q |
| |
|
|||||| |||||| ||||| |||||||| | |||||| | |||||||||||||||||| ||||||||| |||||||||| || |||| |||||| | |
|
|
| T |
20286 |
ttagcttagttggcagggacattgcataatttatgcatggatcgaggttcgaaccccggataccccacttatccacatttaattgcgtgagttctagcta |
20385 |
T |
 |
| Q |
234 |
ctaggctac |
242 |
Q |
| |
|
||||||||| |
|
|
| T |
20386 |
ctaggctac |
20394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 66629 - 66573
Alignment:
| Q |
154 |
attgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
66629 |
attgcatattatatgcaggggccggggttcgaaccccggacacctcacttccccaca |
66573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 94660 - 94736
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||||||||||||| ||||||||||| | ||||||||| | | ||||||||||||||||||| |||| ||||||| |
|
|
| T |
94660 |
ttagctcagttggtatggatattgcatgtcatatgcaggggtcagggttcgaaccccggacacctcactcctccaca |
94736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 135 - 200
Target Start/End: Original strand, 7082 - 7148
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
||||||||||| |||||| | ||||| |||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
7082 |
tagctcagttgttagggacaatgcattattatatgcaggggccggggttcgaaccccggacacccca |
7148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 201
Target Start/End: Complemental strand, 3660 - 3587
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccac |
201 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||| |||| | |||||||||||| ||| ||||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatgccggagtccgtgttcgaaccccgaacatcccac |
3587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 172
Target Start/End: Complemental strand, 3704 - 3663
Alignment:
| Q |
131 |
agtttagctcagttggtagggatattgcatattatatgcagg |
172 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3704 |
agtttagcttagttggtaaggatattgcatattatatgcagg |
3663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 25032 - 25101
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
25032 |
tagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccactt |
25101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 39664 - 39731
Alignment:
| Q |
143 |
ttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| | | ||||||| |||| || ||||||||||| |||| |
|
|
| T |
39664 |
ttggtagggatattgcatattatatgcaggggttggggttcgagccccagataccccacttcttcaca |
39731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 242
Target Start/End: Complemental strand, 59239 - 59131
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccacattt-atatgtgtgaactctagcc |
232 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| | || |||||||| | |||||||||| || ||||||||| | || ||||| ||||| || |
|
|
| T |
59239 |
ttagttcagttggtagagatattgcatattatatgcagg-ggcggggttcgaatcttggacaccccatttttccacatttaaaatttgtgagctctaacc |
59141 |
T |
 |
| Q |
233 |
actaggctac |
242 |
Q |
| |
|
||||| |||| |
|
|
| T |
59140 |
actagactac |
59131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 242
Target Start/End: Original strand, 60305 - 60369
Alignment:
| Q |
180 |
gttcgaaccccggacaccccacttctccacattt--atatgtgtgaactctagccactaggctac |
242 |
Q |
| |
|
||||||||| | ||||||| |||||||||||||| | |||||||||||||| |||||| ||||| |
|
|
| T |
60305 |
gttcgaacctcagacaccctacttctccacatttaaaaatgtgtgaactctaaccactaagctac |
60369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 242
Target Start/End: Complemental strand, 8973 - 8866
Alignment:
| Q |
138 |
ctcagttggtagggatattgcatattatatgc--aggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccac |
234 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||| | || |||||||||| | |||||| || |||| |||| ||| | ||||||| ||||||||| |
|
|
| T |
8973 |
ctcaattggtagggatattgcatattatatgcagaggggtcggggttcgaacctcagacacctcatttcttcacaattaaattgtgtgagttctagccac |
8874 |
T |
 |
| Q |
235 |
taggctac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
8873 |
taggctac |
8866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 119 - 242
Target Start/End: Complemental strand, 50077 - 49953
Alignment:
| Q |
119 |
tttatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatat |
217 |
Q |
| |
|
||||| || ||||| ||| |||||||| |||||||||||||||||||||| ||| | ||||||||| |||||||| | |||||||||| ||||| | |
|
|
| T |
50077 |
tttattcccgtgagcttaactcagttgatagggatattgcatattatatgtaggggttagggttcgaactccggacactctacttctccacaatttaatt |
49978 |
T |
 |
| Q |
218 |
gtgtgaactctagccactaggctac |
242 |
Q |
| |
|
|||||| ||||| | ||||| |||| |
|
|
| T |
49977 |
gtgtgagctctaactactagactac |
49953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 147 - 237
Target Start/End: Complemental strand, 94032 - 93939
Alignment:
| Q |
147 |
tagggatattgcatat--tatatgcaggagccgaggttcgaaccccggacaccccacttctccacatttata-tgtgtgaactctagccactag |
237 |
Q |
| |
|
|||||||||||||||| |||||| ||| | | ||||||||| |||||||||||||||||||||| ||| | ||| ||| ||||||||||||| |
|
|
| T |
94032 |
tagggatattgcatatattatatgtaggggttggggttcgaactccggacaccccacttctccacaattaaattgtatgagctctagccactag |
93939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1005 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1005
Description:
Target: scaffold1005; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 240
Target Start/End: Original strand, 2888 - 2947
Alignment:
| Q |
181 |
ttcgaaccccggacaccccacttctccacatttatatgtgtgaactctagccactaggct |
240 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
2888 |
ttcgaaccctggacacctcacttctccacatttaattgtgtgagctctagccattaggct |
2947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 122 - 165
Target Start/End: Original strand, 45881 - 45924
Alignment:
| Q |
122 |
atccctgtgagtttagctcagttggtagggatattgcatattat |
165 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 170
Target Start/End: Original strand, 510964 - 511001
Alignment:
| Q |
133 |
tttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
510964 |
tttagctcagttagtagggatattgcatattatatgca |
511001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 203
Target Start/End: Original strand, 419712 - 419787
Alignment:
| Q |
129 |
tgagtttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||| |||||||| |||||| |||||| || | | ||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
419712 |
tgagcttagctcatttggtaagggataatgaacaatatgtgcaggggccggggttcgaaccccggacaccccactt |
419787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 200
Target Start/End: Complemental strand, 6696 - 6656
Alignment:
| Q |
160 |
tattatatgcaggagccgaggttcgaaccccggacacccca |
200 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6696 |
tattatatgcaggggccggggttcgaaccccggacacccca |
6656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 242
Target Start/End: Original strand, 5985 - 6095
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaact |
226 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||||| || |||| ||||||| ||||| |||||||| ||| ||||| ||||||| || |
|
|
| T |
5985 |
gtgagcttagctcatttgatagggatattgcatattatatgtgggggccggagttcgaa-----gacactccacttcttcacaatttaattgtgtgagct |
6079 |
T |
 |
| Q |
227 |
ctagccactaggctac |
242 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
6080 |
ctaaccactaggctac |
6095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 141 - 238
Target Start/End: Complemental strand, 20247 - 20148
Alignment:
| Q |
141 |
agttggtagggatatt-gcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac-atttatatgtgtgaactctagccactagg |
238 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| | || | |||||||| ||||||| |||||||| ||| ||||| ||||||| | ||||||||||| |
|
|
| T |
20247 |
agttggtagggatatttgcattttatatgcaggggtcgggtttcgaaccacggacactccacttcttcacaatttaattgtgtgagatttagccactagg |
20148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 210
Target Start/End: Original strand, 4884 - 4966
Alignment:
| Q |
128 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccaca |
210 |
Q |
| |
|
||||| || |||||||| |||||||||||||||| |||||||||| | ||| ||||||||||||| |||||||||||| |
|
|
| T |
4884 |
gtgagcttggctcagttagtagggatattgcataatatatgcagggattggagtttgaaccccggacacttcacttctccaca |
4966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 196
Target Start/End: Original strand, 45949 - 46011
Alignment:
| Q |
134 |
ttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacac |
196 |
Q |
| |
|
||||||||||||||| | ||| || ||| |||||||| || ||||||||||||||||| |||| |
|
|
| T |
45949 |
ttagctcagttggtaagaataatgtataatatatgcaagatccgaggttcgaaccccgaacac |
46011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 203
Target Start/End: Original strand, 22464 - 22534
Alignment:
| Q |
134 |
ttagctcagttggta-gggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||| |||||| |||||| | ||||||||||| ||| || |||||||||||||| |||| ||||||| |
|
|
| T |
22464 |
ttagctcacttggtaagggataatacatattatatgtaggggctgaggttcgaaccccagacatcccactt |
22534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 53843 - 53769
Alignment:
| Q |
123 |
tccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacacc |
197 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| | |||||| || ||||| | ||| |||||||| |||||||||| |
|
|
| T |
53843 |
tccccgtgagtttagctcagttggtaaggacagtgcataatacatgcaaggtccggggttcgaatcccggacacc |
53769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 4894 - 4826
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||| ||||| | ||||| |||||||||||| || | |||||||| |||||||||||||||| |
|
|
| T |
4894 |
tagctcagttggcagggacaatgcattattatatgcaggggcgg-ggttcgaatcccggacaccccactt |
4826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0148 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 9245 - 9282
Alignment:
| Q |
177 |
gaggttcgaaccccggacaccccacttctccacattta |
214 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
9245 |
gaggtttgaaccccgaacaccccacttctccacattta |
9282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 1046 - 1114
Alignment:
| Q |
135 |
tagctcagttggtagggatattgcata-ttatatgcaggagccgaggttcgaaccccggacaccccactt |
203 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||||| ||| || | |||||||||||| |||||||||||| |
|
|
| T |
1046 |
tagctcagttggtagggacat-gcataattatatgtaggggctggggttcgaaccccagacaccccactt |
1114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 170
Target Start/End: Complemental strand, 221073 - 221032
Alignment:
| Q |
129 |
tgagtttagctcagttggtagggatattgcatattatatgca |
170 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| |||||||| |
|
|
| T |
221073 |
tgagtttagctcagttggtagggataatacataatatatgca |
221032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University