View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_high_36 (Length: 204)
Name: NF0678_high_36
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0678_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 852605 - 852492
Alignment:
Q |
1 |
ttattcttccacagctgttctatctaactccctttcagtgtttactcaggcactgtagctggagctcgagaggccttcttcaatgatatcccttcaatct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
852605 |
ttattcttccacagctgttctatctaactccctttcagtgtttactcaggcactgtagctggagctcgagaggccttcttcaatgatatcccttcaatct |
852506 |
T |
 |
Q |
101 |
ctatttcatatgac |
114 |
Q |
|
|
|||||||||||||| |
|
|
T |
852505 |
ctatttcatatgac |
852492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 29 - 119
Target Start/End: Complemental strand, 847645 - 847555
Alignment:
Q |
29 |
tccctttcagtgtttactcaggcactgtagctggagctcgagaggccttcttcaatgatatcccttcaatctctatttcatatgactggta |
119 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||| |
|
|
T |
847645 |
tccctttcagtgtttactcaggcactgtagctggagctcgagaggccttcttcaacaatatcccttctatctccatttcatatgactggta |
847555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 36 - 123
Target Start/End: Original strand, 47054797 - 47054884
Alignment:
Q |
36 |
cagtgtttactcaggcactgtagctggagctcgagaggccttcttcaatgatatcccttcaatctctatttcatatgactggtatatt |
123 |
Q |
|
|
|||||||||||||||||| || ||||||||||||||||| |||||| ||||||| ||||| ||||| |||||||| |||||||||||| |
|
|
T |
47054797 |
cagtgtttactcaggcacagttgctggagctcgagaggcattcttctatgatataccttctatctccatttcatacgactggtatatt |
47054884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 42 - 120
Target Start/End: Original strand, 47063994 - 47064072
Alignment:
Q |
42 |
ttactcaggcactgtagctggagctcgagaggccttcttcaatgatatcccttcaatctctatttcatatgactggtat |
120 |
Q |
|
|
|||||||||||| || |||| || | || |||| |||||| ||||||| ||||| ||||| |||||||||||||||||| |
|
|
T |
47063994 |
ttactcaggcacagttgctgaagtttgaaaggcattcttctatgatataccttctatctccatttcatatgactggtat |
47064072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University