View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_21 (Length: 357)
Name: NF0678_low_21
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0678_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 29052264 - 29052414
Alignment:
Q |
13 |
aatattaaaaggtcttcgatcctaccttactgaaaaatgagaccagcaagggagaaaggaatttaggtaccattgatgcttggctgcaactggtgaggca |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
29052264 |
aatattaaaaggtcttcgatcctaccttactgaaaaatgagaccagcaagggagaaaggaatttaggtaccattgatacttggctgcaactggtgaggca |
29052363 |
T |
 |
Q |
113 |
tgacagagggaagaaaatgactcgcaaatccagtacttcgacaaacaccaa |
163 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29052364 |
tgacagagggaagaaaatgactcgcaaatccagtacttcgacaaacaccaa |
29052414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 160 - 261
Target Start/End: Original strand, 29052449 - 29052550
Alignment:
Q |
160 |
ccaataggggagaaggctgcaacaaggtatactcttatgtccagtggtggttggagtacctgcactaaacgaagggtttgtggaataaggaagaaatgat |
259 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
T |
29052449 |
ccaataggggagaaggctgcaacaaggtatactcttatgtccagtggtggttggagtacctccactaaacgaagagtttgtggaataaggaagaaatgat |
29052548 |
T |
 |
Q |
260 |
gt |
261 |
Q |
|
|
|| |
|
|
T |
29052549 |
gt |
29052550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University