View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_25 (Length: 332)
Name: NF0678_low_25
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0678_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 79 - 321
Target Start/End: Complemental strand, 51197042 - 51196800
Alignment:
| Q |
79 |
aagaagaacctataaggatggaataccatatgtttgagaagaatacattttgcaatggggcagcgtttgtgcctagagatggaggtgtcgaagaagatga |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51197042 |
aagaagaacctataaggatggaataccatatgtttgagaagaatacattttgcaatggggcagcgtttgtgcctagagatggaggtgtcgaagaagatga |
51196943 |
T |
 |
| Q |
179 |
tggttggatcattacttttgttcacaatgaagatactaacacatctcaagtaggttgagtagctttgtattcttgaaattaattacacttgttgaaaatt |
278 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51196942 |
tggtttgatcattacttttgttcacaatgaagatactaacacatctcaagtaggttgagtagctttgtattcttgaaattaattacacttgttgaaaatt |
51196843 |
T |
 |
| Q |
279 |
aggatagttattaactcatttatcaattttctttcaggttcat |
321 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51196842 |
aggatagttattaactcatttatcgattttctttcaggttcat |
51196800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University