View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_26 (Length: 321)
Name: NF0678_low_26
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0678_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 42 - 195
Target Start/End: Complemental strand, 456118 - 455965
Alignment:
| Q |
42 |
atgacatttatttttcttcatgttatgactgttttttcttatacagttttgacatttagcccaagtataaaagaaaaacactcgattatatacttaattg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456118 |
atgacatttatttttcttcatgttatgactgttttttcttatacagttttgacatttagcccaagtataaaagaaaaacactcgattatatacttaattg |
456019 |
T |
|
| Q |
142 |
tcattatttttattccaaagggtaagaaagaaggtataatgtgtgatcggtggg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456018 |
tcattatttttattccaaagggtaagaaagaaggtataatgtgtgatcggtggg |
455965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1386 times since January 2019
Visitors: 4368