View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0678_low_31 (Length: 312)

Name: NF0678_low_31
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0678_low_31
NF0678_low_31
[»] chr5 (1 HSPs)
chr5 (80-312)||(42578947-42579179)
[»] scaffold0703 (1 HSPs)
scaffold0703 (85-208)||(1863-1986)
[»] chr1 (2 HSPs)
chr1 (85-208)||(12460971-12461094)
chr1 (102-192)||(13190525-13190615)
[»] chr6 (1 HSPs)
chr6 (85-208)||(16861010-16861133)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 80 - 312
Target Start/End: Original strand, 42578947 - 42579179
Alignment:
80 gatggacatcatcatccagtttacccatttagaacaaaatcccatcttgaaaagaattgcttgtaagtaagaccagcttacgctatcgaaggctttggat 179  Q
    |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||    
42578947 gatgcacatcatcatccaatttacccatttagaacaaaatcccatcttgaaaagaattgcttgtaagtaagaccaacttacgctatcgaagactttggat 42579046  T
180 atatcaagtttcaaggcaatctcacctttgttcccttagttttgcagcacatgatgtgaaggatttcaaatgccgtaagagcattgttcatgatggattt 279  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||| |||||||||| |    
42579047 atatcaagtttcaaggcaatctcacctttgttcccttagttttgcagcgcatggtgtgaaggatttcaaatgccgttagagcattgtccatgatggatct 42579146  T
280 tgagtggacaaatgttgcctgctctagagatat 312  Q
    |||||||| ||| | |||||||||| |||||||    
42579147 tgagtggaaaaaggctgcctgctctggagatat 42579179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0703 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0703
Description:

Target: scaffold0703; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 85 - 208
Target Start/End: Original strand, 1863 - 1986
Alignment:
85 acatcatcatccagtttacccatttagaacaaaatcccatcttgaaaagaattgcttgtaagtaagaccagcttacgctatcgaaggctttggatatatc 184  Q
    |||||||||||||  ||||||||| ||||||||| |||| |||   ||||||  |||| |  ||||||||||| || || || || ||||||||||||||    
1863 acatcatcatccaagttacccattgagaacaaaaacccaacttttcaagaataacttgaagataagaccagctgacactgtcaaatgctttggatatatc 1962  T
185 aagtttcaaggcaatctcaccttt 208  Q
    ||||||||| |||| |||||||||    
1963 aagtttcaaagcaacctcaccttt 1986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 85 - 208
Target Start/End: Original strand, 12460971 - 12461094
Alignment:
85 acatcatcatccagtttacccatttagaacaaaatcccatcttgaaaagaattgcttgtaagtaagaccagcttacgctatcgaaggctttggatatatc 184  Q
    |||||||||||||  ||||||||| ||||||||| |||| |||   ||||||  |||| |  ||||||||||| || || || || ||||||||||||||    
12460971 acatcatcatccaagttacccattgagaacaaaaacccaacttttcaagaataacttgaagataagaccagctgacactgtcaaatgctttggatatatc 12461070  T
185 aagtttcaaggcaatctcaccttt 208  Q
    ||||||||| |||| |||||||||    
12461071 aagtttcaaagcaacctcaccttt 12461094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 13190525 - 13190615
Alignment:
102 acccatttagaacaaaatcccatcttgaaaagaattgcttgtaagtaagaccagcttacgctatcgaaggctttggatatatcaagtttca 192  Q
    |||||||  |||||||||||||||||   |||||| ||||  | ||| |||||||||| |||||| || ||||| ||||||||||||||||    
13190525 acccattgtgaacaaaatcccatcttagtaagaatagcttcgaggtatgaccagcttatgctatcaaaagcttttgatatatcaagtttca 13190615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 85 - 208
Target Start/End: Complemental strand, 16861133 - 16861010
Alignment:
85 acatcatcatccagtttacccatttagaacaaaatcccatcttgaaaagaattgcttgtaagtaagaccagcttacgctatcgaaggctttggatatatc 184  Q
    |||||||||||||  ||| ||||| ||||||||| |||| |||   |||||| ||||| |  ||||||||||| || || || || ||||||||||| ||    
16861133 acatcatcatccaagttatccattgagaacaaaaacccaacttttcaagaatagcttgaagataagaccagctgacactgtcaaatgctttggatatgtc 16861034  T
185 aagtttcaaggcaatctcaccttt 208  Q
    ||||||||| |||| |||||||||    
16861033 aagtttcaaagcaacctcaccttt 16861010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University