View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_33 (Length: 307)
Name: NF0678_low_33
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0678_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 61 - 231
Target Start/End: Complemental strand, 50504859 - 50504689
Alignment:
Q |
61 |
aatatatagtttgatgaaaaatgagaagggtccctgctccttcaggcagagtagagggcatgacacttagccgacgcatctgcatattaatgttcttaac |
160 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50504859 |
aatatatagtttgatgaaaaatgagaagggtccctgctccttcaggcagagtagagggcaggacacttagccgacgcatctgcatattaatgttcttaac |
50504760 |
T |
 |
Q |
161 |
cgattcaaaggtgaagctcggaagtacgagttgacactgaagaagtattaagaaaggatgtatatggttcc |
231 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50504759 |
cgattcaaaggtgaagctcggaagtacgagttgacactgaagaagtattaagaaaggatgtatatggttcc |
50504689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1276 times since January 2019
Visitors: 4365