View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0678_low_35 (Length: 295)
Name: NF0678_low_35
Description: NF0678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0678_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 260
Target Start/End: Original strand, 40663827 - 40664080
Alignment:
| Q |
7 |
tccaccgcaattctggaacgtaagaaggtgccaaatcggcttgtcgtggacgaggctgttaacgatgataactctattgtcgccatgcaccctcaaacca |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40663827 |
tccaccgcgattctggaacgtaagaaggcgccaaatcggcttgtcgtggacgaggctgttaacggtgataactctattgtcgccatgcaccctcaaacca |
40663926 |
T |
 |
| Q |
107 |
tggaaaagttagggcttttccgaggcgatactatcctcatcaaggtaatatattttgatcactaccatatttactattcgctttccctccaaaaatagat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40663927 |
tggaaaagttagggcttttccgaggcgatactatcctcatcaaggtaatatattttgatcactaccatatttactattcgcttttcctccaaaaatagat |
40664026 |
T |
 |
| Q |
207 |
gaagtaaatttccaatttggcaaagtcgaacggtgtgttaccaagttagggttt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
40664027 |
gaagtaaatttccaatttggcaaagtcaaatggtgtgttaccaagttagggttt |
40664080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University